rs606231197

Variant names:

• chrX-48902483-GGAGGAGCTGGCTCCCTATCCCAA-G
• rs606231197
• NM_001032382.2:c.547_569delGAGCTGGCTCCCTATCCCAAGAG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_001032382.2(PQBP1):​c.547_569delGAGCTGGCTCCCTATCCCAAGAG​(p.Glu183GlnfsTer9) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 21)
• Consequence: PQBP1 NM_001032382.2 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 7.50
• Publications: 1 publications found

Genes affected

PQBP1 (HGNC:9330): (polyglutamine binding protein 1) This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]

PQBP1 Gene-Disease associations (from GenCC):

• Renpenning syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, ClinGen
• hamel cerebro-palato-cardiac syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability, Golabi-Ito-hall type

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability, Porteous type

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability, Sutherland-Haan type

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant X-48902483-GGAGGAGCTGGCTCCCTATCCCAA-G is Pathogenic according to our data. Variant chrX-48902483-GGAGGAGCTGGCTCCCTATCCCAA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 10983.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PQBP1	NM_001032382.2	c.547_569delGAGCTGGCTCCCTATCCCAAGAG	p.Glu183GlnfsTer9	frameshift_variant	Exon 5 of 7	ENST00000447146.7	NP_001027554.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PQBP1	ENST00000447146.7	c.547_569delGAGCTGGCTCCCTATCCCAAGAG	p.Glu183GlnfsTer9	frameshift_variant	Exon 5 of 7	1	NM_001032382.2	ENSP00000391759.2

Frequencies

GnomAD3 genomes Cov.: 21

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 21

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Renpenning syndrome Pathogenic:1

Apr 01, 2006

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs606231197; hg19: chrX-48759760;