rs606231365

Variant names:

• chr10-89014409-G-GAAAATTCAAACTTCAGAAAT
• rs606231365
• NM_000043.6:c.968_987dupAAAATTCAAACTTCAGAAAT

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PVS1_Moderate PP5

The NM_001410956.1(FAS):​c.1013_1032dupAAAATTCAAACTTCAGAAAT​(p.Glu345LysfsTer38) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: FAS NM_001410956.1 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.92
• Publications: 2 publications found

Genes affected

FAS (HGNC:11920): (Fas cell surface death receptor) The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]

FAS Gene-Disease associations (from GenCC):

• autoimmune lymphoproliferative syndrome

  Inheritance: AD, AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• autoimmune lymphoproliferative syndrome type 1

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.019 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PP5: Variant 10-89014409-G-GAAAATTCAAACTTCAGAAAT is Pathogenic according to our data. Variant chr10-89014409-G-GAAAATTCAAACTTCAGAAAT is described in ClinVar as Pathogenic. ClinVar VariationId is 16509.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001410956.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FAS	NM_000043.6	MANE Select	c.968_987dupAAAATTCAAACTTCAGAAAT	p.Glu330LysfsTer38	frameshift	Exon 9 of 9	NP_000034.1
	FAS	NM_001410956.1		c.1013_1032dupAAAATTCAAACTTCAGAAAT	p.Glu345LysfsTer38	frameshift	Exon 9 of 9	NP_001397885.1
	FAS	NM_152871.4		c.905_924dupAAAATTCAAACTTCAGAAAT	p.Glu309LysfsTer38	frameshift	Exon 8 of 8	NP_690610.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FAS	ENST00000652046.1	MANE Select	c.968_987dupAAAATTCAAACTTCAGAAAT	p.Glu330LysfsTer38	frameshift	Exon 9 of 9	ENSP00000498466.1
	FAS	ENST00000357339.7	TSL:1	c.905_924dupAAAATTCAAACTTCAGAAAT	p.Glu309LysfsTer38	frameshift	Exon 8 of 8	ENSP00000349896.2
	FAS	ENST00000355279.2	TSL:1	c.*280_*299dupAAAATTCAAACTTCAGAAAT		3_prime_UTR	Exon 8 of 8	ENSP00000347426.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	AUTOIMMUNE LYMPHOPROLIFERATIVE SYNDROME, TYPE IA (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9
Mutation Taster		=96/104	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs606231365; hg19: chr10-90774166;