Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PVS1_ModeratePP5
The NM_000043.6(FAS):c.968_987dupAAAATTCAAACTTCAGAAAT(p.Glu330LysfsTer38) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
FAS (HGNC:11920): (Fas cell surface death receptor) The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]
FAS Gene-Disease associations (from GenCC):
autoimmune lymphoproliferative syndrome
Inheritance: AD, AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0198 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
PP5
Variant 10-89014409-G-GAAAATTCAAACTTCAGAAAT is Pathogenic according to our data. Variant chr10-89014409-G-GAAAATTCAAACTTCAGAAAT is described in ClinVar as Pathogenic. ClinVar VariationId is 16509.Status of the report is no_assertion_criteria_provided, 0 stars.