rs606231372

Variant names:

• chrX-108687507-TGGTCCAGATGGATTGCAAGGTCCCCCA-T
• rs606231372
• NM_033380.3:c.4347_4373delAGATGGATTGCAAGGTCCCCCAGGTCC

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM2 PM4 PP3 PP5_Moderate

The NM_033380.3(COL4A5):​c.4347_4373delAGATGGATTGCAAGGTCCCCCAGGTCC​(p.Asp1450_Pro1458del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: COL4A5 NM_033380.3 disruptive_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 10.0

Genes affected

COL4A5 (HGNC:2207): (collagen type IV alpha 5 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. Mutations in this gene are associated with X-linked Alport syndrome, also known as hereditary nephritis. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_033380.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-108687507-TGGTCCAGATGGATTGCAAGGTCCCCCA-T is Pathogenic according to our data. Variant chrX-108687507-TGGTCCAGATGGATTGCAAGGTCCCCCA-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3597987.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chrX-108687507-TGGTCCAGATGGATTGCAAGGTCCCCCA-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
COL4A5	NM_033380.3	c.4347_4373delAGATGGATTGCAAGGTCCCCCAGGTCC	p.Asp1450_Pro1458del	disruptive_inframe_deletion	Exon 49 of 53	ENST00000328300.11	NP_203699.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
COL4A5	ENST00000328300.11	c.4347_4373delAGATGGATTGCAAGGTCCCCCAGGTCC	p.Asp1450_Pro1458del	disruptive_inframe_deletion	Exon 49 of 53	1	NM_033380.3	ENSP00000331902.7

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

X-linked Alport syndrome Pathogenic:1

Feb 27, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs606231372; hg19: chrX-107930737;