rs606231372

Variant names:

• chrX-108687507-TGGTCCAGATGGATTGCAAGGTCCCCCA-T
• rs606231372
• NM_033380.3:c.4347_4373delAGATGGATTGCAAGGTCCCCCAGGTCC

Variant summary

Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PM1 PM4 PP3 PP5_Moderate

The NM_033380.3(COL4A5):​c.4347_4373delAGATGGATTGCAAGGTCCCCCAGGTCC​(p.Asp1450_Pro1458del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: COL4A5 NM_033380.3 disruptive_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 10.0
• Publications: 0 publications found

Genes affected

COL4A5 (HGNC:2207): (collagen type IV alpha 5 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. Mutations in this gene are associated with X-linked Alport syndrome, also known as hereditary nephritis. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]

COL4A5 Gene-Disease associations (from GenCC):

• Alport syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen, G2P
• X-linked Alport syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Genomics England PanelApp, Myriad Women’s Health, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 7 ACMG points.

• PM1: In a hotspot region, there are 12 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 2 benign, 3 uncertain in NM_033380.3
• PM4: Nonframeshift variant in NON repetitive region in NM_033380.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-108687507-TGGTCCAGATGGATTGCAAGGTCCCCCA-T is Pathogenic according to our data. Variant chrX-108687507-TGGTCCAGATGGATTGCAAGGTCCCCCA-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 3597987.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_033380.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL4A5	NM_033380.3	MANE Select	c.4347_4373delAGATGGATTGCAAGGTCCCCCAGGTCC	p.Asp1450_Pro1458del	disruptive_inframe_deletion	Exon 49 of 53	NP_203699.1
	COL4A5	NM_000495.5		c.4329_4355delAGATGGATTGCAAGGTCCCCCAGGTCC	p.Asp1444_Pro1452del	disruptive_inframe_deletion	Exon 47 of 51	NP_000486.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL4A5	ENST00000328300.11	TSL:1 MANE Select	c.4347_4373delAGATGGATTGCAAGGTCCCCCAGGTCC	p.Asp1450_Pro1458del	disruptive_inframe_deletion	Exon 49 of 53	ENSP00000331902.7
	COL4A5	ENST00000361603.7	TSL:2	c.4329_4355delAGATGGATTGCAAGGTCCCCCAGGTCC	p.Asp1444_Pro1452del	disruptive_inframe_deletion	Exon 47 of 51	ENSP00000354505.2
	COL4A5	ENST00000515658.1	TSL:5	c.141_167delAGATGGATTGCAAGGTCCCCCAGGTCC	p.Asp48_Pro56del	disruptive_inframe_deletion	Exon 3 of 4	ENSP00000423520.1

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

ClinVar submissions as Germline

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	X-linked Alport syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs606231372; hg19: chrX-107930737;