rs606231470

Variant names:

• chr20-62830373-CACAAGGCCCTCCCGGAGCCCCTG-C
• rs606231470
• NM_001853.4:c.1176_1198delACAAGGCCCTCCCGGAGCCCCTG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_001853.4(COL9A3):​c.1176_1198delACAAGGCCCTCCCGGAGCCCCTG​(p.Gln393CysfsTer25) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: COL9A3 NM_001853.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 8.04
• Publications: 2 publications found

Genes affected

COL9A3 (HGNC:2219): (collagen type IX alpha 3 chain) This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. Mutations in this gene are associated with multiple epiphyseal dysplasia type 3. [provided by RefSeq, Jan 2010]

COL9A3 Gene-Disease associations (from GenCC):

• epiphyseal dysplasia, multiple, 3

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Illumina, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• Stickler syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, LIMITED Submitted by: ClinGen, Ambry Genetics, Genomics England PanelApp
• Stickler syndrome, type 6

  Inheritance: AR Classification: DEFINITIVE, STRONG, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• multiple epiphyseal dysplasia due to collagen 9 anomaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive Stickler syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 20-62830373-CACAAGGCCCTCCCGGAGCCCCTG-C is Pathogenic according to our data. Variant chr20-62830373-CACAAGGCCCTCCCGGAGCCCCTG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 161450.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001853.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL9A3	NM_001853.4	MANE Select	c.1176_1198delACAAGGCCCTCCCGGAGCCCCTG	p.Gln393CysfsTer25	frameshift	Exon 23 of 32	NP_001844.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL9A3	ENST00000649368.1	MANE Select	c.1176_1198delACAAGGCCCTCCCGGAGCCCCTG	p.Gln393CysfsTer25	frameshift	Exon 23 of 32	ENSP00000496793.1	Q14050
	COL9A3	ENST00000934236.1		c.1227_1249delACAAGGCCCTCCCGGAGCCCCTG	p.Gln410CysfsTer25	frameshift	Exon 24 of 33	ENSP00000604295.1
	COL9A3	ENST00000894732.1		c.1104_1126delACAAGGCCCTCCCGGAGCCCCTG	p.Gln369CysfsTer25	frameshift	Exon 22 of 31	ENSP00000564791.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Stickler syndrome, type 6 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.0
Mutation Taster		=16/184	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs606231470; hg19: chr20-61461725;