rs6143734
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1
The NM_018702.4(ADARB2):c.101-110673_101-110647delGTGTTTGATCCTAATATGCTAATTATT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.111 in 152,210 control chromosomes in the GnomAD database, including 1,680 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_018702.4 intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_018702.4. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes AF: 0.111 AC: 16888AN: 152092Hom.: 1672 Cov.: 31 show subpopulations
GnomAD4 genome AF: 0.111 AC: 16911AN: 152210Hom.: 1680 Cov.: 31 AF XY: 0.118 AC XY: 8814AN XY: 74418 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.