rs6143734

Variant names:

• chr10-1489806-TAATAATTAGCATATTAGGATCAAACAC-T
• rs6143734
• NM_018702.4:c.101-110673_101-110647delGTGTTTGATCCTAATATGCTAATTATT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The NM_018702.4(ADARB2):​c.101-110673_101-110647delGTGTTTGATCCTAATATGCTAATTATT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.111 in 152,210 control chromosomes in the GnomAD database, including 1,680 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.11 (1680 hom., cov: 31)
• Consequence: ADARB2 NM_018702.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.885
• Publications: 1 publications found

Genes affected

ADARB2 (HGNC:227): (adenosine deaminase RNA specific B2 (inactive)) This gene encodes a member of the double-stranded RNA adenosine deaminase family of RNA-editing enzymes and may play a regulatory role in RNA editing. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.334 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ADARB2	NM_018702.4	c.101-110673_101-110647delGTGTTTGATCCTAATATGCTAATTATT		intron_variant	Intron 1 of 9	ENST00000381312.6	NP_061172.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ADARB2	ENST00000381312.6	c.101-110673_101-110647delGTGTTTGATCCTAATATGCTAATTATT		intron_variant	Intron 1 of 9	1	NM_018702.4	ENSP00000370713.1

Frequencies

GnomAD3 genomes AF: 0.111 AC: 16888 AN: 152092 Hom.: 1672 Cov.: 31

Gnomad AFR AF: 0.0245

Gnomad AMI AF: 0.118

Gnomad AMR AF: 0.286

Gnomad ASJ AF: 0.113

Gnomad EAS AF: 0.347

Gnomad SAS AF: 0.202

Gnomad FIN AF: 0.129

Gnomad MID AF: 0.158

Gnomad NFE AF: 0.0969

Gnomad OTH AF: 0.116

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.111 AC: 16911 AN: 152210 Hom.: 1680 Cov.: 31 AF XY: 0.118 AC XY: 8814 AN XY: 74418

African (AFR) AF: 0.0246 AC: 1022 AN: 41564

American (AMR) AF: 0.287 AC: 4384 AN: 15272

Ashkenazi Jewish (ASJ) AF: 0.113 AC: 393 AN: 3470

East Asian (EAS) AF: 0.347 AC: 1795 AN: 5168

South Asian (SAS) AF: 0.202 AC: 972 AN: 4816

European-Finnish (FIN) AF: 0.129 AC: 1363 AN: 10606

Middle Eastern (MID) AF: 0.160 AC: 47 AN: 294

European-Non Finnish (NFE) AF: 0.0969 AC: 6588 AN: 67998

Other (OTH) AF: 0.113 AC: 239 AN: 2110

Alfa AF: 0.107 Hom.: 122

Bravo AF: 0.124

Asia WGS AF: 0.235 AC: 816 AN: 3478

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.89
Mutation Taster		=39/61	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs6143734; hg19: chr10-1532001;