rs63749749

Variant names:

• chrX-154030620-GGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT-G
• rs61752992
• NM_001110792.2:c.1200_1243delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC

Variant summary

Our verdict is Pathogenic. The variant received 17 ACMG points: 17P and 0B. PVS1 PS2 PM2_Supporting PS4

This summary comes from the ClinGen Evidence Repository: The p.Pro389* variant in MECP2 is predicted to cause a premature stop codon that leads to a truncated or absent protein where loss-of-function is an established mechanism. There is significant evidence that loss of this region of the gene is pathogenic (PVS1). The p.Pro389* variant in MECP2 has been reported as a de novo occurrence (biological parentage confirmed) in at least 2 individuals with Rett syndrome (internal database, GeneDx) (PS2_very strong). This variant has been observed in at least 5 other individuals with Rett syndrome (PMID 26984561, 21982064, 20151026, 19652677, RettBASE) (PS4). The p.Pro389* variant in MECP2 is absent from gnomAD (PM2_supporting). In summary, the p.Pro389* variant in MECP2 is classified as Pathogenic for Rett syndrome based on the ACMG/AMP criteria (PVS1, PS2_very strong, PS4, PM2_supporting). LINK:https://erepo.genome.network/evrepo/ui/classification/CA198846/MONDO:0010726/016

• Frequency:
  • Genomes: not found (cov: 17)
  • Exomes 𝑓: 9.1e-7 (0 hom. 0 hem.)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:42
• Conservation: PhyloP100: 4.53
• Publications: 12 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 17 ACMG points.

• PVS1: For more information check the summary or visit ClinGen Evidence Repository.
• PS2: For more information check the summary or visit ClinGen Evidence Repository.
• PS4: For more information check the summary or visit ClinGen Evidence Repository.
• PM2: For more information check the summary or visit ClinGen Evidence Repository.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	NM_001110792.2	MANE Select	c.1200_1243delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC	p.Pro401fs	frameshift	Exon 3 of 3	NP_001104262.1
	MECP2	NM_004992.4	MANE Plus Clinical	c.1164_1207delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC	p.Pro389fs	frameshift	Exon 4 of 4	NP_004983.1
	MECP2	NM_001316337.2		c.885_928delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC	p.Pro296fs	frameshift	Exon 5 of 5	NP_001303266.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	ENST00000453960.7	TSL:1 MANE Select	c.1200_1243delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC	p.Pro401fs	frameshift	Exon 3 of 3	ENSP00000395535.2
	MECP2	ENST00000303391.11	TSL:1 MANE Plus Clinical	c.1164_1207delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC	p.Pro389fs	frameshift	Exon 4 of 4	ENSP00000301948.6
	MECP2	ENST00000630151.3	TSL:5	c.1164_1207delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC	p.Pro389fs	frameshift	Exon 4 of 4	ENSP00000486089.2

Frequencies

GnomAD3 genomes Cov.: 17

GnomAD4 exome AF: 9.14e-7 AC: 1 AN: 1094103 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 361233

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 26390

American (AMR) AF: 0.00 AC: 0 AN: 35147

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19379

East Asian (EAS) AF: 0.00 AC: 0 AN: 30200

South Asian (SAS) AF: 0.00 AC: 0 AN: 54114

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 37106

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3976

European-Non Finnish (NFE) AF: 0.00000119 AC: 1 AN: 841758

Other (OTH) AF: 0.00 AC: 0 AN: 46033

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 17

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
14	-	-	Rett syndrome (14)
7	-	-	not provided (7)
3	-	-	MECP2-related disorder (3)
3	-	-	Rett syndrome;C0796222:X-linked intellectual disability-psychosis-macroorchidism syndrome;C1845336:Autism, susceptibility to, X-linked 3;C1846058:Syndromic X-linked intellectual disability Lubs type;C1968556:Severe neonatal-onset encephalopathy with microcephaly (3)
3	-	-	Severe neonatal-onset encephalopathy with microcephaly (3)
3	-	-	X-linked intellectual disability-psychosis-macroorchidism syndrome (3)
2	-	-	Autism, susceptibility to, X-linked 3 (2)
1	-	-	Delayed speech and language development;C1836843:Loss of ambulation;C1837658:Delayed gross motor development (1)
1	-	-	Inborn genetic diseases (1)
1	-	-	not specified (1)
1	-	-	Rett syndrome, zappella variant (1)
1	-	-	See cases (1)
1	-	-	Smith-Magenis Syndrome-like (1)
1	-	-	Syndromic X-linked intellectual disability Lubs type (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs61752992; hg19: chrX-153296071;