rs63749749

Variant names:

• chrX-154030620-GGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT-G
• rs61752992
• NM_001110792.2:c.1200_1243delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC

Variant summary

Our verdict is Pathogenic. Variant got 17 ACMG points: 17P and 0B. PS4 PVS1 PS2 PM2_Supporting

This summary comes from the ClinGen Evidence Repository: The p.Pro389* variant in MECP2 is predicted to cause a premature stop codon that leads to a truncated or absent protein where loss-of-function is an established mechanism. There is significant evidence that loss of this region of the gene is pathogenic (PVS1). The p.Pro389* variant in MECP2 has been reported as a de novo occurrence (biological parentage confirmed) in at least 2 individuals with Rett syndrome (internal database, GeneDx) (PS2_very strong). This variant has been observed in at least 5 other individuals with Rett syndrome (PMID 26984561, 21982064, 20151026, 19652677, RettBASE) (PS4). The p.Pro389* variant in MECP2 is absent from gnomAD (PM2_supporting). In summary, the p.Pro389* variant in MECP2 is classified as Pathogenic for Rett syndrome based on the ACMG/AMP criteria (PVS1, PS2_very strong, PS4, PM2_supporting). LINK:https://erepo.genome.network/evrepo/ui/classification/CA198846/MONDO:0010726/016

• Frequency:
  • Genomes: not found (cov: 17)
  • Exomes 𝑓: 9.1e-7 (0 hom. 0 hem.)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:41
• Conservation: PhyloP100: 4.53

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Pathogenic. Variant got 17 ACMG points.

• PVS1: For more information check the summary or visit ClinGen Evidence Repository.
• PS2: For more information check the summary or visit ClinGen Evidence Repository.
• PS4: For more information check the summary or visit ClinGen Evidence Repository.
• PM2: For more information check the summary or visit ClinGen Evidence Repository.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2	c.1200_1243delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC	p.Pro401fs	frameshift_variant	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4	c.1164_1207delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC	p.Pro389fs	frameshift_variant	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7	c.1200_1243delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC	p.Pro401fs	frameshift_variant	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11	c.1164_1207delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC	p.Pro389fs	frameshift_variant	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6
MECP2	ENST00000407218	c.*536_*579delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC		3_prime_UTR_variant	Exon 4 of 4	5		ENSP00000384865.2
MECP2	ENST00000628176	c.*536_*579delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC		3_prime_UTR_variant	Exon 5 of 5	3		ENSP00000486978.1

Frequencies

GnomAD3 genomes Cov.: 17

GnomAD4 exome AF: 9.14e-7 AC: 1 AN: 1094103 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 361233

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000119

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 17

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:41

Revision: reviewed by expert panel

Submissions by phenotype

Rett syndrome Pathogenic:13

Pathogenic, criteria provided, single submitter	curation	Centre for Population Genomics, CPG	Aug 14, 2023	This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria.Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 2.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). This variant is absent from gnomAD (PM2_Supporting). -
Pathogenic, criteria provided, single submitter	clinical testing	Genetic Services Laboratory, University of Chicago	Jun 24, 2015	- -
Pathogenic, criteria provided, single submitter	clinical testing	Molecular Genetics Laboratory, Children's Mercy Hospital and Clinics	-	- -
Pathogenic, criteria provided, single submitter	clinical testing	Institute of Human Genetics, University of Leipzig Medical Center	Feb 23, 2023	Criteria applied: PS2_VSTR, PVS1_STR, PS4_MOD, PM2_SUP also in this individual: identification of pathogenic heterozygous variants NM_003682.4:c.3362-1G>C and NM_003682.4:c.3458_3459del in MADD gene (phase unknown) which might be disease causing for MADD-associated NDD (suspected dual phenotype) -
Pathogenic, criteria provided, single submitter	clinical testing	DASA	Mar 05, 2022	The c.1200_1243del;p.(Pro401*) variant creates a premature translational stop signal in the MECP2 gene. It is expected to result in an absent or disrupted protein product - PVS1_strong. This sequence change has been observed in affected individual(s) and ClinVar contains an entry for this variant (ClinVar ID: 143406; PMID 26984561; PMID: 21982064; PMID: 20151026; PMID: 19652677) - PS4. This variant is not present in population databases (rs61752992- gnomAD; ABraOM no frequency - http://abraom.ib.usp.br/) - PM2. In summary, the currently available evidence indicates that the variant is pathogenic. -
Pathogenic, criteria provided, single submitter	clinical testing	Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center	Jun 06, 2022	PVS1, PS2, PS4, PS3, PM2 -
Pathogenic, criteria provided, single submitter	clinical testing	Mendelics	May 28, 2019	- -
Pathogenic, no assertion criteria provided	clinical testing	Clinical Genomics Laboratory, Stanford Medicine	Dec 17, 2019	The p.Pro389* variant in the MECP2 gene has been previously reported in >20 unrelated individuals with classic or variant Rett syndrome (Buyse et al., 2000; Li et al., 2007; Zahorakova et al., 2007; Augenstein et al., 2009; Bebbington et al., 2010; Psoni et al., 2012; Halbach et al., 2016; Krishnaraj et al., 2017). The p.Pro389* variant was identified de novo in this individual and previously reported de novo in at least two additional individuals with classic or variant Rett syndrome (Zahorakova et al., 2007; Psoni et al., 2012). This variant was absent from large population databases, including the Genome Aggregation Database (http://gnomad.broadinstitute.org/); however, the ability to detect this type of variation is limited. The p.Pro389* (c.1164_1207del44) variant results in 44 base pair deletion, which causes a premature termination codon 1 amino acid downstream. This premature termination codon is in exon 4 of 4 coding exons, and is therefore not predicted to undergo nonsense-mediated decay, increasing the likelihood of an expressed protein. This variant is located in the C-terminal region of MECP2. Frameshift and other truncating variants have been well described in this region and are predicted to disrupt the function of MECP2 (Kaur et al., 2019). These data were assessed using the ACMG/AMP variant interpretation guidelines. In summary, there is sufficient evidence to classify the c.1164_1207del44 variant as pathogenic for X-linked MECP2-associated disorders, based on the information above. [ACMG evidence codes used: PVS1, PS2; PS4, PM2_supporting] -
Pathogenic, criteria provided, single submitter	clinical testing	Institute of Human Genetics Munich, Klinikum Rechts Der Isar, TU München	Jun 10, 2021	- -
Pathogenic, criteria provided, single submitter	clinical testing	Victorian Clinical Genetics Services, Murdoch Childrens Research Institute	Oct 09, 2024	Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease in this gene and is associated with Rett syndrome (MIM#312750). (I) 0110 - This gene is known to be predominantly associated with X-linked dominant disease. However, X-linked recessive disease has also been reported. In addition, both random and skewed inactivation have been seen in females (OMIM), the latter usually present a milder phenotype or no symptoms (PMID: 20301670). (I) 0205 - Variant is predicted to result in a truncated protein (premature termination codon is NOT located at least 54 nucleotides upstream of the final exon-exon junction) with less than 1/3 of the protein sequence affected. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0701 - Other truncation variants comparable to the one identified in this case have very strong previous evidence for pathogenicity (ClinVar, DECIPHER). (SP) 0801 - This variant has very strong previous evidence of pathogenicity in unrelated individuals presenting different phenotypes, such as classical Rett syndrome, atypical Rett syndrome, and intellectual disability or autism without Rett syndrome. This variant has also been classified as pathogenic for Rett syndrome by an expert panel in ClinVar (DECIPHER, PMID: 32472557, 21982064). (SP) 1208 - Inheritance information for this variant is not currently available in this individual. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign -
Pathogenic, no assertion criteria provided	clinical testing	Clinical Genetics Laboratory, University Hospital Schleswig-Holstein	Nov 04, 2022	- -
Pathogenic, no assertion criteria provided	curation	RettBASE	Aug 10, 2012	- -
Pathogenic, reviewed by expert panel	curation	ClinGen Rett and Angelman-like Disorders Variant Curation Expert Panel	Mar 24, 2021	The p.Pro389* variant in MECP2 is predicted to cause a premature stop codon that leads to a truncated or absent protein where loss-of-function is an established mechanism. There is significant evidence that loss of this region of the gene is pathogenic (PVS1). The p.Pro389* variant in MECP2 has been reported as a de novo occurrence (biological parentage confirmed) in at least 2 individuals with Rett syndrome (internal database, GeneDx) (PS2_very strong). This variant has been observed in at least 5 other individuals with Rett syndrome (PMID 26984561, 21982064, 20151026, 19652677, RettBASE) (PS4). The p.Pro389* variant in MECP2 is absent from gnomAD (PM2_supporting). In summary, the p.Pro389* variant in MECP2 is classified as Pathogenic for Rett syndrome based on the ACMG/AMP criteria (PVS1, PS2_very strong, PS4, PM2_supporting). -

not provided Pathogenic:7

Pathogenic, criteria provided, single submitter	clinical testing	Eurofins Ntd Llc (ga)	Nov 22, 2014	- -
Pathogenic, criteria provided, single submitter	clinical testing	Laboratory of Molecular Genetics (Pr. Bezieau's lab), CHU de Nantes	Dec 12, 2019	- -
Pathogenic, criteria provided, single submitter	clinical testing	GeneDx	Nov 05, 2021	Reported previously in females and males with classic Rett syndrome or a Rett-like phenotype in the published literature, please note that this variant is referred to as c.1158del44, using alternate nomenclature, by Dayer et al., 2007 (Huppke et al., 2006; Dayer et al., 2007; RettBASE); Nonsense variant in the C-terminus predicted to result in protein truncation as the last 98 amino acids are lost, and other loss-of-function variants have been reported downstream in the Human Gene Mutation Database and at GeneDx (Stenson et al., 2014); Not observed in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 21982064, 28394482, 30536762, 22357617, 20151026, 21878110, 17089071, 16077736, 11055898, 23921973, 16690727, 12111643, 11738883, 16473305, 19652677, 12966523, 17387578, 10854091, 16844334, 11738879, 18562141, 22516699, 28263302, 27799067, 26795593, 29390993, 34015165, 32472557, 29718204) -
Pathogenic, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Jul 01, 2024	MECP2: PVS1:Strong, PM2, PS2:Moderate, PS4:Moderate -
Pathogenic, criteria provided, single submitter	clinical testing	Revvity Omics, Revvity	Sep 27, 2019	- -
Pathogenic, criteria provided, single submitter	clinical testing	Illumina Laboratory Services, Illumina	Nov 21, 2022	The MECP2 c.1200_1243del (p.Pro401Ter) nonsense variant results in the substitution of proline at amino acid position 401 with a stop codon. This variant results in a premature termination codon in the last exon of the MECP2 gene. While this may not lead to nonsense-mediated decay, it is expected to create a truncated protein. Across a selection of the available literature, this variant has been identified at least 11 individuals with Rett syndrome and Rett syndrome-like phenotypes, including in a heterozygous state in nine females and in a hemizygous state in two males (PMID: 20151026; PMID: 21982064; PMID: 26984561). The variant was shown to segregate with the condition in three generations in one family, with females displaying a milder phenotype that corresponded to the degree of X-chromosome inactivation (PMID: 20151026). This variant is not found in version 2.1.1 or version 3.1.2 of the Genome Aggregation Database. This variant has also been curated by the ClinGen Rett and Angelman-like Disorders Variant Curation Expert Panel and classified as pathogenic. Based on the available evidence, the c.1200_1243del (p.Pro401Ter) variant is classified as pathogenic for MECP2-related disorders. -
Pathogenic, criteria provided, single submitter	clinical testing	Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen	Sep 15, 2021	- -

Rett syndrome;C0796222:X-linked intellectual disability-psychosis-macroorchidism syndrome;C1845336:Autism, susceptibility to, X-linked 3;C1846058:Syndromic X-linked intellectual disability Lubs type;C1968556:Severe neonatal-onset encephalopathy with microcephaly Pathogenic:3

Pathogenic, criteria provided, single submitter	clinical testing	Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago	Nov 11, 2021	MECP2 NM_004992.3 exon 4 p.Pro389* (c.1164_1207del): This variant has been reported in the literature in several individuals with Rett syndrome (Dayer 2007 PMID:16844334, Zaharakova 2007 PMID:17387578, Bebbington 2010 PMID:19914908, RettBASE (http://mecp2.chw.edu.au/mecp2/index.php)). Of note, the reported clinical phenotype of these individuals was variable and features were present in both male and female probands. This variant is not present in large control databases. This variant is present in ClinVar, with several labs classifying this variant as pathogenic (Variation ID:143406). Evolutionary conservation and computational predictive tools for this variant are limited or unavailable. This variant represents a deletion of 44 nucleotides and creates a premature stop at codon 389 which results in an absent or abnormal protein. Loss of function variants have been reported in association with disease for this gene. In summary, this variant is classified as pathogenic. -
Pathogenic, criteria provided, single submitter	clinical testing	Molecular Genetics Lab, CHRU Brest	-	- -
Pathogenic, criteria provided, single submitter	clinical testing	Fulgent Genetics, Fulgent Genetics	Apr 13, 2024	- -

X-linked intellectual disability-psychosis-macroorchidism syndrome Pathogenic:3

Pathogenic, criteria provided, single submitter	clinical testing	Pittsburgh Clinical Genomics Laboratory, University of Pittsburgh Medical Center	Jan 26, 2023	This sequence variant is a deletion of 44 nucleotides beginning at coding nucleotide 1164 in the MECP2 gene. This variant changes the Pro389 codon into an early truncation sigl which removes the fil 98 amino acids of the MECP2 protein. This is a previously reported variant (ClinVar) which has been observed in many individuals with Rett syndrome and Rett-like phenotypes (PMID: 26984561, 21982064, 16473305, 20151026, 19914908); the variant is frequently de novo, and the associated phenotype is often a milder form of Rett syndrome. This variant is absent from the gnomAD population database (0/~198000 alleles). This variant has been classified as pathogenic by the ClinGen Rett and Angelman-like disorders expert group since March 24, 2021. Based upon the available evidence, we consider this variant to be pathogenic. ACMG Criteria: PM2, PP4, PS2, PS4 -
Pathogenic, no assertion criteria provided	curation	RettBASE	Aug 10, 2012	- -
Pathogenic, criteria provided, single submitter	clinical testing	Department of Genetics, Rouen University Hospital, Normandy Center for Genomic and Personalized Medicine	Jan 20, 2021	- -

MECP2-related disorder Pathogenic:3

Pathogenic, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Jul 06, 2023	Variant summary: MECP2 c.1164_1207del44 (p.Pro389X) results in a premature termination codon, predicted to cause a truncation of the encoded protein, which is a commonly known mechanism for disease. While this variant is not expected to result in nonsense-mediated decay, it is expected to disrupt the last 98 amino acids of the protein. The variant was absent in 177202 control chromosomes (gnomAD). c.1164_1207del44 has been reported in the literature in multiple heterozygous females and hemizygous males affected with features of Rett Syndrome, and several females with the variant displayed milder phenotypes due to X-chromosome inactivation, including the preserved speech variant of Rett syndrome (e.g., Stembalska_2011, Augenstein_2009, Neul_2019). The variant has also been shown to segregate with disease in related individuals (e.g., Augenstein_2009). These data indicate that the variant is very likely to be associated with disease. The following publications have been ascertained in the context of this evaluation (PMID: 22516699, 20151026, 30536762). Multiple submitters have reported clinical-significance assessments for this variant to ClinVar after 2014. All submitters classified the variant as pathogenic (n = 23). Based on the evidence outlined above, the variant was classified as pathogenic. -
Pathogenic, criteria provided, single submitter	clinical testing	Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego	-	This variant is found in the last exon of MECP2 and predicted to result in truncation of the MeCP2 protein. This variant has been previously reported as a heterozygous change in both males and females with Rett syndrome whose clinical phenotypes were variable (PMID 26984561, 21982064, 20151026, 19652677). The c.1200_1243del (p.Pro401Ter) variant is absent from the gnomAD population database and thus is presumed to be rare. Based on the available evidence, the c.1200_1243del (p.Pro401Ter) variant is classified as Pathogenic. -
Pathogenic, no assertion criteria provided	clinical testing	PreventionGenetics, part of Exact Sciences	Aug 02, 2024	The MECP2 c.1164_1207del44 variant is predicted to result in premature protein termination (p.Pro389*). This variant has been reported as a recurrent pathogenic variant in individuals with typical and atypical Rett syndrome (Li et al. 2007. PubMed ID: 17089071; Zahorakova et al. 2007. PubMed ID: 17387578; Buyse et al. 2000. PubMed ID: 11055898). This variant has not been reported in gnomAD, indicating this variant is rare. Nonsense variants in MECP2 are expected to be pathogenic. This variant is interpreted as pathogenic. -

Severe neonatal-onset encephalopathy with microcephaly Pathogenic:3

Pathogenic, no assertion criteria provided	curation	RettBASE	Aug 10, 2012	- -
Pathogenic, criteria provided, single submitter	clinical testing	Genetics and Prenatal Diagnosis Center, The First Affiliated Hospital of Zhengzhou University	May 13, 2021	- -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 06, 2025	This sequence change creates a premature translational stop signal (p.Pro389*) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 98 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individuals with Rett syndrome or intellectual disability (PMID: 17089071, 17387578, 19914908, 20151026, 21982064). This variant is also known as c.1164_1207del44. ClinVar contains an entry for this variant (Variation ID: 143406). For these reasons, this variant has been classified as Pathogenic. -

Autism, susceptibility to, X-linked 3 Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Centre for Mendelian Genomics, University Medical Centre Ljubljana	Jan 01, 2016	This variant was classified as: Pathogenic. -
Pathogenic, no assertion criteria provided	curation	RettBASE	Aug 10, 2012	- -

Inborn genetic diseases Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Apr 30, 2015

- -

Delayed speech and language development;C1836843:Loss of ambulation;C1837658:Delayed gross motor development Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Centre for Mendelian Genomics, University Medical Centre Ljubljana

Mar 07, 2014

- -

not specified Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Sep 13, 2018

The MECP2 c.1164_1207del44; p.Pro389Ter variant (rs63749749), is reported in the literature in multiple individuals and families affected with Rett syndrome or intellectual disability (Bebbington 2010, Li 2007, see link to RettBASE and references therein). This variant is reported as pathogenic by multiple laboratories in ClinVar (Variation ID: 143406), and is absent from general population databases (1000 Genomes Project, Exome Variant Server, and Genome Aggregation Database), indicating it is not a common polymorphism. This variant results in a premature termination codon in the last exon of the MECP2 gene. While this may not lead to nonsense-mediated decay, it is expected to create a truncated protein. Additionally, other truncating variants downstream have been identified in patients with Rett syndrome and are considered pathogenic (RettBASE and references therein). Based on available information, the p.Pro389Ter variant is considered to be pathogenic. References: Link to RettBASE: http://mecp2.chw.edu.au/mecp2/index.php Bebbington A et al. Updating the profile of C-terminal MECP2 deletions in Rett syndrome. J Med Genet. 2010 Apr;47(4):242-8. Li MR et al. MECP2 and CDKL5 gene mutation analysis in Chinese patients with Rett syndrome. J Hum Genet. 2007;52(1):38-47. -

Syndromic X-linked intellectual disability Lubs type Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre

Mar 25, 2024

- -

Rett syndrome, zappella variant Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

May 01, 2000

- -

See cases Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Genetics Laboratory, UDIAT-Centre Diagnòstic, Hospital Universitari Parc Tauli

Apr 26, 2021

PVS1_strong;PP5_strong;PM2_supporting;PM6_moderate -

Smith-Magenis Syndrome-like Pathogenic:1

Pathogenic, criteria provided, single submitter

research

Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine

Aug 15, 2016

mother presented with highly skewed x inactivation; daughter was random. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs61752992; hg19: chrX-153296071;