rs63749749
Variant summary
Our verdict is Pathogenic. Variant got 17 ACMG points: 17P and 0B. PS4PVS1PS2PM2_Supporting
This summary comes from the ClinGen Evidence Repository: The p.Pro389* variant in MECP2 is predicted to cause a premature stop codon that leads to a truncated or absent protein where loss-of-function is an established mechanism. There is significant evidence that loss of this region of the gene is pathogenic (PVS1). The p.Pro389* variant in MECP2 has been reported as a de novo occurrence (biological parentage confirmed) in at least 2 individuals with Rett syndrome (internal database, GeneDx) (PS2_very strong). This variant has been observed in at least 5 other individuals with Rett syndrome (PMID 26984561, 21982064, 20151026, 19652677, RettBASE) (PS4). The p.Pro389* variant in MECP2 is absent from gnomAD (PM2_supporting). In summary, the p.Pro389* variant in MECP2 is classified as Pathogenic for Rett syndrome based on the ACMG/AMP criteria (PVS1, PS2_very strong, PS4, PM2_supporting). LINK:https://erepo.genome.network/evrepo/ui/classification/CA198846/MONDO:0010726/016
Frequency
Consequence
NM_001110792.2 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 17 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MECP2 | NM_001110792.2 | c.1200_1243delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | p.Pro401fs | frameshift_variant | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
MECP2 | NM_004992.4 | c.1164_1207delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | p.Pro389fs | frameshift_variant | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MECP2 | ENST00000453960.7 | c.1200_1243delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | p.Pro401fs | frameshift_variant | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
MECP2 | ENST00000303391.11 | c.1164_1207delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | p.Pro389fs | frameshift_variant | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 | ||
MECP2 | ENST00000407218 | c.*536_*579delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | 3_prime_UTR_variant | Exon 4 of 4 | 5 | ENSP00000384865.2 | ||||
MECP2 | ENST00000628176 | c.*536_*579delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | 3_prime_UTR_variant | Exon 5 of 5 | 3 | ENSP00000486978.1 |
Frequencies
GnomAD3 genomes Cov.: 17
GnomAD4 exome AF: 9.14e-7 AC: 1AN: 1094103Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 361233
GnomAD4 genome Cov.: 17
ClinVar
Submissions by phenotype
Rett syndrome Pathogenic:13
Pathogenic, criteria provided, single submitter | curation | Centre for Population Genomics, CPG | Aug 14, 2023 | This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria.Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 2.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). This variant is absent from gnomAD (PM2_Supporting). - |
Pathogenic, criteria provided, single submitter | clinical testing | Genetic Services Laboratory, University of Chicago | Jun 24, 2015 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Molecular Genetics Laboratory, Children's Mercy Hospital and Clinics | - | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Institute of Human Genetics, University of Leipzig Medical Center | Feb 23, 2023 | Criteria applied: PS2_VSTR, PVS1_STR, PS4_MOD, PM2_SUP also in this individual: identification of pathogenic heterozygous variants NM_003682.4:c.3362-1G>C and NM_003682.4:c.3458_3459del in MADD gene (phase unknown) which might be disease causing for MADD-associated NDD (suspected dual phenotype) - |
Pathogenic, criteria provided, single submitter | clinical testing | DASA | Mar 05, 2022 | The c.1200_1243del;p.(Pro401*) variant creates a premature translational stop signal in the MECP2 gene. It is expected to result in an absent or disrupted protein product - PVS1_strong. This sequence change has been observed in affected individual(s) and ClinVar contains an entry for this variant (ClinVar ID: 143406; PMID 26984561; PMID: 21982064; PMID: 20151026; PMID: 19652677) - PS4. This variant is not present in population databases (rs61752992- gnomAD; ABraOM no frequency - http://abraom.ib.usp.br/) - PM2. In summary, the currently available evidence indicates that the variant is pathogenic. - |
Pathogenic, criteria provided, single submitter | clinical testing | Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center | Jun 06, 2022 | PVS1, PS2, PS4, PS3, PM2 - |
Pathogenic, criteria provided, single submitter | clinical testing | Mendelics | May 28, 2019 | - - |
Pathogenic, no assertion criteria provided | clinical testing | Clinical Genomics Laboratory, Stanford Medicine | Dec 17, 2019 | The p.Pro389* variant in the MECP2 gene has been previously reported in >20 unrelated individuals with classic or variant Rett syndrome (Buyse et al., 2000; Li et al., 2007; Zahorakova et al., 2007; Augenstein et al., 2009; Bebbington et al., 2010; Psoni et al., 2012; Halbach et al., 2016; Krishnaraj et al., 2017). The p.Pro389* variant was identified de novo in this individual and previously reported de novo in at least two additional individuals with classic or variant Rett syndrome (Zahorakova et al., 2007; Psoni et al., 2012). This variant was absent from large population databases, including the Genome Aggregation Database (http://gnomad.broadinstitute.org/); however, the ability to detect this type of variation is limited. The p.Pro389* (c.1164_1207del44) variant results in 44 base pair deletion, which causes a premature termination codon 1 amino acid downstream. This premature termination codon is in exon 4 of 4 coding exons, and is therefore not predicted to undergo nonsense-mediated decay, increasing the likelihood of an expressed protein. This variant is located in the C-terminal region of MECP2. Frameshift and other truncating variants have been well described in this region and are predicted to disrupt the function of MECP2 (Kaur et al., 2019). These data were assessed using the ACMG/AMP variant interpretation guidelines. In summary, there is sufficient evidence to classify the c.1164_1207del44 variant as pathogenic for X-linked MECP2-associated disorders, based on the information above. [ACMG evidence codes used: PVS1, PS2; PS4, PM2_supporting] - |
Pathogenic, criteria provided, single submitter | clinical testing | Institute of Human Genetics Munich, Klinikum Rechts Der Isar, TU München | Jun 10, 2021 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Victorian Clinical Genetics Services, Murdoch Childrens Research Institute | Oct 09, 2024 | Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease in this gene and is associated with Rett syndrome (MIM#312750). (I) 0110 - This gene is known to be predominantly associated with X-linked dominant disease. However, X-linked recessive disease has also been reported. In addition, both random and skewed inactivation have been seen in females (OMIM), the latter usually present a milder phenotype or no symptoms (PMID: 20301670). (I) 0205 - Variant is predicted to result in a truncated protein (premature termination codon is NOT located at least 54 nucleotides upstream of the final exon-exon junction) with less than 1/3 of the protein sequence affected. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0701 - Other truncation variants comparable to the one identified in this case have very strong previous evidence for pathogenicity (ClinVar, DECIPHER). (SP) 0801 - This variant has very strong previous evidence of pathogenicity in unrelated individuals presenting different phenotypes, such as classical Rett syndrome, atypical Rett syndrome, and intellectual disability or autism without Rett syndrome. This variant has also been classified as pathogenic for Rett syndrome by an expert panel in ClinVar (DECIPHER, PMID: 32472557, 21982064). (SP) 1208 - Inheritance information for this variant is not currently available in this individual. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign - |
Pathogenic, no assertion criteria provided | clinical testing | Clinical Genetics Laboratory, University Hospital Schleswig-Holstein | Nov 04, 2022 | - - |
Pathogenic, no assertion criteria provided | curation | RettBASE | Aug 10, 2012 | - - |
Pathogenic, reviewed by expert panel | curation | ClinGen Rett and Angelman-like Disorders Variant Curation Expert Panel | Mar 24, 2021 | The p.Pro389* variant in MECP2 is predicted to cause a premature stop codon that leads to a truncated or absent protein where loss-of-function is an established mechanism. There is significant evidence that loss of this region of the gene is pathogenic (PVS1). The p.Pro389* variant in MECP2 has been reported as a de novo occurrence (biological parentage confirmed) in at least 2 individuals with Rett syndrome (internal database, GeneDx) (PS2_very strong). This variant has been observed in at least 5 other individuals with Rett syndrome (PMID 26984561, 21982064, 20151026, 19652677, RettBASE) (PS4). The p.Pro389* variant in MECP2 is absent from gnomAD (PM2_supporting). In summary, the p.Pro389* variant in MECP2 is classified as Pathogenic for Rett syndrome based on the ACMG/AMP criteria (PVS1, PS2_very strong, PS4, PM2_supporting). - |
not provided Pathogenic:7
Pathogenic, criteria provided, single submitter | clinical testing | Eurofins Ntd Llc (ga) | Nov 22, 2014 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Laboratory of Molecular Genetics (Pr. Bezieau's lab), CHU de Nantes | Dec 12, 2019 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | GeneDx | Nov 05, 2021 | Reported previously in females and males with classic Rett syndrome or a Rett-like phenotype in the published literature, please note that this variant is referred to as c.1158del44, using alternate nomenclature, by Dayer et al., 2007 (Huppke et al., 2006; Dayer et al., 2007; RettBASE); Nonsense variant in the C-terminus predicted to result in protein truncation as the last 98 amino acids are lost, and other loss-of-function variants have been reported downstream in the Human Gene Mutation Database and at GeneDx (Stenson et al., 2014); Not observed in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 21982064, 28394482, 30536762, 22357617, 20151026, 21878110, 17089071, 16077736, 11055898, 23921973, 16690727, 12111643, 11738883, 16473305, 19652677, 12966523, 17387578, 10854091, 16844334, 11738879, 18562141, 22516699, 28263302, 27799067, 26795593, 29390993, 34015165, 32472557, 29718204) - |
Pathogenic, criteria provided, single submitter | clinical testing | CeGaT Center for Human Genetics Tuebingen | Jul 01, 2024 | MECP2: PVS1:Strong, PM2, PS2:Moderate, PS4:Moderate - |
Pathogenic, criteria provided, single submitter | clinical testing | Revvity Omics, Revvity | Sep 27, 2019 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Illumina Laboratory Services, Illumina | Nov 21, 2022 | The MECP2 c.1200_1243del (p.Pro401Ter) nonsense variant results in the substitution of proline at amino acid position 401 with a stop codon. This variant results in a premature termination codon in the last exon of the MECP2 gene. While this may not lead to nonsense-mediated decay, it is expected to create a truncated protein. Across a selection of the available literature, this variant has been identified at least 11 individuals with Rett syndrome and Rett syndrome-like phenotypes, including in a heterozygous state in nine females and in a hemizygous state in two males (PMID: 20151026; PMID: 21982064; PMID: 26984561). The variant was shown to segregate with the condition in three generations in one family, with females displaying a milder phenotype that corresponded to the degree of X-chromosome inactivation (PMID: 20151026). This variant is not found in version 2.1.1 or version 3.1.2 of the Genome Aggregation Database. This variant has also been curated by the ClinGen Rett and Angelman-like Disorders Variant Curation Expert Panel and classified as pathogenic. Based on the available evidence, the c.1200_1243del (p.Pro401Ter) variant is classified as pathogenic for MECP2-related disorders. - |
Pathogenic, criteria provided, single submitter | clinical testing | Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen | Sep 15, 2021 | - - |
Rett syndrome;C0796222:X-linked intellectual disability-psychosis-macroorchidism syndrome;C1845336:Autism, susceptibility to, X-linked 3;C1846058:Syndromic X-linked intellectual disability Lubs type;C1968556:Severe neonatal-onset encephalopathy with microcephaly Pathogenic:3
Pathogenic, criteria provided, single submitter | clinical testing | Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago | Nov 11, 2021 | MECP2 NM_004992.3 exon 4 p.Pro389* (c.1164_1207del): This variant has been reported in the literature in several individuals with Rett syndrome (Dayer 2007 PMID:16844334, Zaharakova 2007 PMID:17387578, Bebbington 2010 PMID:19914908, RettBASE (http://mecp2.chw.edu.au/mecp2/index.php)). Of note, the reported clinical phenotype of these individuals was variable and features were present in both male and female probands. This variant is not present in large control databases. This variant is present in ClinVar, with several labs classifying this variant as pathogenic (Variation ID:143406). Evolutionary conservation and computational predictive tools for this variant are limited or unavailable. This variant represents a deletion of 44 nucleotides and creates a premature stop at codon 389 which results in an absent or abnormal protein. Loss of function variants have been reported in association with disease for this gene. In summary, this variant is classified as pathogenic. - |
Pathogenic, criteria provided, single submitter | clinical testing | Molecular Genetics Lab, CHRU Brest | - | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Fulgent Genetics, Fulgent Genetics | Apr 13, 2024 | - - |
X-linked intellectual disability-psychosis-macroorchidism syndrome Pathogenic:3
Pathogenic, criteria provided, single submitter | clinical testing | Pittsburgh Clinical Genomics Laboratory, University of Pittsburgh Medical Center | Jan 26, 2023 | This sequence variant is a deletion of 44 nucleotides beginning at coding nucleotide 1164 in the MECP2 gene. This variant changes the Pro389 codon into an early truncation sigl which removes the fil 98 amino acids of the MECP2 protein. This is a previously reported variant (ClinVar) which has been observed in many individuals with Rett syndrome and Rett-like phenotypes (PMID: 26984561, 21982064, 16473305, 20151026, 19914908); the variant is frequently de novo, and the associated phenotype is often a milder form of Rett syndrome. This variant is absent from the gnomAD population database (0/~198000 alleles). This variant has been classified as pathogenic by the ClinGen Rett and Angelman-like disorders expert group since March 24, 2021. Based upon the available evidence, we consider this variant to be pathogenic. ACMG Criteria: PM2, PP4, PS2, PS4 - |
Pathogenic, no assertion criteria provided | curation | RettBASE | Aug 10, 2012 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Department of Genetics, Rouen University Hospital, Normandy Center for Genomic and Personalized Medicine | Jan 20, 2021 | - - |
MECP2-related disorder Pathogenic:3
Pathogenic, criteria provided, single submitter | clinical testing | Women's Health and Genetics/Laboratory Corporation of America, LabCorp | Jul 06, 2023 | Variant summary: MECP2 c.1164_1207del44 (p.Pro389X) results in a premature termination codon, predicted to cause a truncation of the encoded protein, which is a commonly known mechanism for disease. While this variant is not expected to result in nonsense-mediated decay, it is expected to disrupt the last 98 amino acids of the protein. The variant was absent in 177202 control chromosomes (gnomAD). c.1164_1207del44 has been reported in the literature in multiple heterozygous females and hemizygous males affected with features of Rett Syndrome, and several females with the variant displayed milder phenotypes due to X-chromosome inactivation, including the preserved speech variant of Rett syndrome (e.g., Stembalska_2011, Augenstein_2009, Neul_2019). The variant has also been shown to segregate with disease in related individuals (e.g., Augenstein_2009). These data indicate that the variant is very likely to be associated with disease. The following publications have been ascertained in the context of this evaluation (PMID: 22516699, 20151026, 30536762). Multiple submitters have reported clinical-significance assessments for this variant to ClinVar after 2014. All submitters classified the variant as pathogenic (n = 23). Based on the evidence outlined above, the variant was classified as pathogenic. - |
Pathogenic, criteria provided, single submitter | clinical testing | Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego | - | This variant is found in the last exon of MECP2 and predicted to result in truncation of the MeCP2 protein. This variant has been previously reported as a heterozygous change in both males and females with Rett syndrome whose clinical phenotypes were variable (PMID 26984561, 21982064, 20151026, 19652677). The c.1200_1243del (p.Pro401Ter) variant is absent from the gnomAD population database and thus is presumed to be rare. Based on the available evidence, the c.1200_1243del (p.Pro401Ter) variant is classified as Pathogenic. - |
Pathogenic, no assertion criteria provided | clinical testing | PreventionGenetics, part of Exact Sciences | Aug 02, 2024 | The MECP2 c.1164_1207del44 variant is predicted to result in premature protein termination (p.Pro389*). This variant has been reported as a recurrent pathogenic variant in individuals with typical and atypical Rett syndrome (Li et al. 2007. PubMed ID: 17089071; Zahorakova et al. 2007. PubMed ID: 17387578; Buyse et al. 2000. PubMed ID: 11055898). This variant has not been reported in gnomAD, indicating this variant is rare. Nonsense variants in MECP2 are expected to be pathogenic. This variant is interpreted as pathogenic. - |
Severe neonatal-onset encephalopathy with microcephaly Pathogenic:3
Pathogenic, no assertion criteria provided | curation | RettBASE | Aug 10, 2012 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Genetics and Prenatal Diagnosis Center, The First Affiliated Hospital of Zhengzhou University | May 13, 2021 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 06, 2025 | This sequence change creates a premature translational stop signal (p.Pro389*) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 98 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individuals with Rett syndrome or intellectual disability (PMID: 17089071, 17387578, 19914908, 20151026, 21982064). This variant is also known as c.1164_1207del44. ClinVar contains an entry for this variant (Variation ID: 143406). For these reasons, this variant has been classified as Pathogenic. - |
Autism, susceptibility to, X-linked 3 Pathogenic:2
Pathogenic, criteria provided, single submitter | clinical testing | Centre for Mendelian Genomics, University Medical Centre Ljubljana | Jan 01, 2016 | This variant was classified as: Pathogenic. - |
Pathogenic, no assertion criteria provided | curation | RettBASE | Aug 10, 2012 | - - |
Inborn genetic diseases Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Apr 30, 2015 | - - |
Delayed speech and language development;C1836843:Loss of ambulation;C1837658:Delayed gross motor development Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Centre for Mendelian Genomics, University Medical Centre Ljubljana | Mar 07, 2014 | - - |
not specified Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories | Sep 13, 2018 | The MECP2 c.1164_1207del44; p.Pro389Ter variant (rs63749749), is reported in the literature in multiple individuals and families affected with Rett syndrome or intellectual disability (Bebbington 2010, Li 2007, see link to RettBASE and references therein). This variant is reported as pathogenic by multiple laboratories in ClinVar (Variation ID: 143406), and is absent from general population databases (1000 Genomes Project, Exome Variant Server, and Genome Aggregation Database), indicating it is not a common polymorphism. This variant results in a premature termination codon in the last exon of the MECP2 gene. While this may not lead to nonsense-mediated decay, it is expected to create a truncated protein. Additionally, other truncating variants downstream have been identified in patients with Rett syndrome and are considered pathogenic (RettBASE and references therein). Based on available information, the p.Pro389Ter variant is considered to be pathogenic. References: Link to RettBASE: http://mecp2.chw.edu.au/mecp2/index.php Bebbington A et al. Updating the profile of C-terminal MECP2 deletions in Rett syndrome. J Med Genet. 2010 Apr;47(4):242-8. Li MR et al. MECP2 and CDKL5 gene mutation analysis in Chinese patients with Rett syndrome. J Hum Genet. 2007;52(1):38-47. - |
Syndromic X-linked intellectual disability Lubs type Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre | Mar 25, 2024 | - - |
Rett syndrome, zappella variant Pathogenic:1
Pathogenic, no assertion criteria provided | literature only | OMIM | May 01, 2000 | - - |
See cases Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Genetics Laboratory, UDIAT-Centre Diagnòstic, Hospital Universitari Parc Tauli | Apr 26, 2021 | PVS1_strong;PP5_strong;PM2_supporting;PM6_moderate - |
Smith-Magenis Syndrome-like Pathogenic:1
Pathogenic, criteria provided, single submitter | research | Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine | Aug 15, 2016 | mother presented with highly skewed x inactivation; daughter was random. - |
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at