rs63751898

Variant names:

• chr4-8871374-CCTCCCCGCCGGGCCCGGTGCCCGCGA-C
• rs63751898
• NM_018942.3:c.215_240delTCGCGGGCACCGGGCCCGGCGGGGAG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_018942.3(HMX1):​c.215_240delTCGCGGGCACCGGGCCCGGCGGGGAG​(p.Leu72ArgfsTer51) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. L72L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: HMX1 NM_018942.3 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 2.21
• Publications: 0 publications found

Genes affected

HMX1 (HGNC:5017): (H6 family homeobox 1) This gene encodes a transcription factor that belongs to the H6 family of homeobox proteins. This protein can bind a 5'-CAAG-3' core DNA sequence, and it is involved in the development of craniofacial structures. Mutations in this gene cause oculoauricular syndrome, a disorder of the eye and external ear. [provided by RefSeq, Oct 2009]

HMX1 Gene-Disease associations (from GenCC):

• oculoauricular syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, G2P, ClinGen, Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 4-8871374-CCTCCCCGCCGGGCCCGGTGCCCGCGA-C is Pathogenic according to our data. Variant chr4-8871374-CCTCCCCGCCGGGCCCGGTGCCCGCGA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 14865.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HMX1	NM_018942.3	c.215_240delTCGCGGGCACCGGGCCCGGCGGGGAG	p.Leu72ArgfsTer51	frameshift_variant	Exon 1 of 2	ENST00000400677.5	NP_061815.2
HMX1	NM_001306142.2	c.215_240delTCGCGGGCACCGGGCCCGGCGGGGAG	p.Leu72ArgfsTer51	frameshift_variant	Exon 1 of 2		NP_001293071.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HMX1	ENST00000400677.5	c.215_240delTCGCGGGCACCGGGCCCGGCGGGGAG	p.Leu72ArgfsTer51	frameshift_variant	Exon 1 of 2	1	NM_018942.3	ENSP00000383516.3
HMX1	ENST00000506970.2	c.215_240delTCGCGGGCACCGGGCCCGGCGGGGAG	p.Leu72ArgfsTer51	frameshift_variant	Exon 1 of 2	1		ENSP00000446997.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Oculoauricular syndrome Pathogenic:1

May 01, 2008

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2
Mutation Taster		=12/188	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs63751898; hg19: chr4-8873100;