rs727503613

Variant names:

• chr2-178608199-TGGGATCTGAAGGTGGACTGAACTTTCCA-GGGATCTGTTTTGGGATCTG
• rs727503613
• NM_001267550.2:c.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_001267550.2(TTN):​c.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC​(p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. P17552P) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TTN NM_001267550.2 missense, disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.94
• Publications: 0 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001267550.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TTN	NM_001267550.2	c.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC	p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln	missense_variant, disruptive_inframe_deletion		ENST00000589042.5	NP_001254479.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TTN	ENST00000589042.5	c.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC	p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln	missense_variant, disruptive_inframe_deletion		5	NM_001267550.2	ENSP00000467141.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Sep 12, 2014

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The Gly14985_Lys14994delins7 variant in TTN has not been previously reported in individuals with cardiomyopathy. Data from large population studies is insuffici ent to assess the frequency of this variant. This variant is a deletion of 29 ba ses and an insertion of 20 bases at cDNA position 44952, resulting in a deletion of 10 amino acids and an insertion of 7 amino acids at position 14985 and is no t predicted to alter the protein reading-frame. It is unclear if this insertion- deletion will impact the protein. In summary, the clinical significance of the G ly14985_Lys14994delins7 variant is uncertain. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs727503613; hg19: chr2-179472926;