rs727503613

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM2PM4PP3

The NM_001267550.2(TTN):​c.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC​(p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. P17552P) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

TTN
NM_001267550.2 missense, disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.94

Publications

0 publications found
Variant links:
Genes affected
TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]
TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_001267550.2.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TTNNM_001267550.2 linkc.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln missense_variant, disruptive_inframe_deletion ENST00000589042.5 NP_001254479.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TTNENST00000589042.5 linkc.52656_52684delTGGAAAGTTCAGTCCACCTTCAGATCCCAinsCAGATCCCAAAACAGATCCC p.Gly17553_Lys17562delinsArgSerGlnAsnArgSerGln missense_variant, disruptive_inframe_deletion 5 NM_001267550.2 ENSP00000467141.1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Uncertain:1
Sep 12, 2014
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The Gly14985_Lys14994delins7 variant in TTN has not been previously reported in individuals with cardiomyopathy. Data from large population studies is insuffici ent to assess the frequency of this variant. This variant is a deletion of 29 ba ses and an insertion of 20 bases at cDNA position 44952, resulting in a deletion of 10 amino acids and an insertion of 7 amino acids at position 14985 and is no t predicted to alter the protein reading-frame. It is unclear if this insertion- deletion will impact the protein. In summary, the clinical significance of the G ly14985_Lys14994delins7 variant is uncertain. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs727503613; hg19: chr2-179472926; API