rs727503696
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4
The NM_001267550.2(TTN):c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC(p.Pro1424_Ser1433del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000744 in 1,613,796 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. S1423S) has been classified as Benign.
Frequency
Consequence
NM_001267550.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TTN | NM_001267550.2 | c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC | p.Pro1424_Ser1433del | disruptive_inframe_deletion | 25/363 | ENST00000589042.5 | NP_001254479.2 | |
TTN | NM_133379.5 | c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC | p.Pro1424_Ser1433del | disruptive_inframe_deletion | 25/46 | ENST00000360870.10 | NP_596870.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TTN | ENST00000589042.5 | c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC | p.Pro1424_Ser1433del | disruptive_inframe_deletion | 25/363 | 5 | NM_001267550.2 | ENSP00000467141.1 | ||
TTN | ENST00000360870.10 | c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC | p.Pro1424_Ser1433del | disruptive_inframe_deletion | 25/46 | 5 | NM_133379.5 | ENSP00000354117.4 |
Frequencies
GnomAD3 genomes AF: 0.00000658 AC: 1AN: 152074Hom.: 0 Cov.: 33
GnomAD3 exomes AF: 0.0000319 AC: 8AN: 250792Hom.: 0 AF XY: 0.0000295 AC XY: 4AN XY: 135532
GnomAD4 exome AF: 0.00000753 AC: 11AN: 1461722Hom.: 0 AF XY: 0.00000825 AC XY: 6AN XY: 727168
GnomAD4 genome AF: 0.00000658 AC: 1AN: 152074Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 74282
ClinVar
Submissions by phenotype
not specified Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine | Jun 27, 2013 | The Ala1430_Pro1439del variant in TTN has not been reported in individuals with cardiomyopathy. Data from large population studies is insufficient to assess the frequency of this variant. This variant is a deletion of 10 amino acid residues from a repetitive region of 5 amino acids repeats. Multiple other mammals have variation in the repeat length of this region, raising the possibility that this change may be tolerated. Additional information is still needed to fully assess the significance of this variant. - |
not provided Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Revvity Omics, Revvity | Feb 24, 2023 | - - |
Cardiovascular phenotype Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Ambry Genetics | Dec 08, 2023 | The c.4131_4160del30 variant (also known as p.A1384_P1393del) is located in coding exon 23 of the TTN gene. This variant results from an in-frame ACCTGCAAGGATGTCTCCTGCACGGATGTC deletion at nucleotide positions 4131 to 4160. This results in the in-frame deletion of ten amino acids (ARMSPARMSP) at codon 1384 to 1393. This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. - |
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at