rs727503696

Variant names:

• chr2-178777885-GGACATCCGTGCAGGAGACATCCTTGCAGGT-G
• rs727503696
• NM_001267550.2:c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001267550.2(TTN):​c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC​(p.Pro1424_Ser1433del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000744 in 1,613,796 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000075 (0 hom.)
• Consequence: TTN NM_001267550.2 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 7.14
• Publications: 0 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

LOC101927055 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001267550.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TTN	NM_001267550.2	c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC	p.Pro1424_Ser1433del	disruptive_inframe_deletion	Exon 25 of 363	ENST00000589042.5	NP_001254479.2
TTN	NM_133379.5	c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC	p.Pro1424_Ser1433del	disruptive_inframe_deletion	Exon 25 of 46	ENST00000360870.10	NP_596870.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TTN	ENST00000589042.5	c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC	p.Pro1424_Ser1433del	disruptive_inframe_deletion	Exon 25 of 363	5	NM_001267550.2	ENSP00000467141.1
TTN	ENST00000360870.10	c.4269_4298delACCTGCAAGGATGTCTCCTGCACGGATGTC	p.Pro1424_Ser1433del	disruptive_inframe_deletion	Exon 25 of 46	5	NM_133379.5	ENSP00000354117.4

Frequencies

GnomAD3 genomes AF: 0.00000658 AC: 1 AN: 152074 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000193

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000319 AC: 8 AN: 250792 AF XY: 0.0000295

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000382

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.000164

GnomAD4 exome AF: 0.00000753 AC: 11 AN: 1461722 Hom.: 0 AF XY: 0.00000825 AC XY: 6 AN XY: 727168

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33466

American (AMR) AF: 0.00 AC: 0 AN: 44714

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26130

East Asian (EAS) AF: 0.000176 AC: 7 AN: 39678

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53414

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1111908

Other (OTH) AF: 0.0000331 AC: 2 AN: 60390

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000007), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000658 AC: 1 AN: 152074 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74282

African (AFR) AF: 0.00 AC: 0 AN: 41408

American (AMR) AF: 0.00 AC: 0 AN: 15248

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.000193 AC: 1 AN: 5190

South Asian (SAS) AF: 0.00 AC: 0 AN: 4822

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10602

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68016

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.0000434 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Uncertain:1

Jun 27, 2013

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The Ala1430_Pro1439del variant in TTN has not been reported in individuals with cardiomyopathy. Data from large population studies is insufficient to assess the frequency of this variant. This variant is a deletion of 10 amino acid residues from a repetitive region of 5 amino acids repeats. Multiple other mammals have variation in the repeat length of this region, raising the possibility that this change may be tolerated. Additional information is still needed to fully assess the significance of this variant. -

not provided Uncertain:1

Feb 24, 2023

Revvity Omics, Revvity

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Cardiovascular phenotype Uncertain:1

Dec 08, 2023

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.4131_4160del30 variant (also known as p.A1384_P1393del) is located in coding exon 23 of the TTN gene. This variant results from an in-frame ACCTGCAAGGATGTCTCCTGCACGGATGTC deletion at nucleotide positions 4131 to 4160. This results in the in-frame deletion of ten amino acids (ARMSPARMSP) at codon 1384 to 1393. This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.1
Mutation Taster		=70/130	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs727503696; hg19: chr2-179642612;