rs727504756
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3
The NM_001267550.2(TTN):c.81005_81028delGCTGCCAAATAAGCAACTACATTG(p.Gly27002_Ile27009del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_001267550.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TTN | MANE Select | c.81005_81028delGCTGCCAAATAAGCAACTACATTG | p.Gly27002_Ile27009del | disruptive_inframe_deletion | Exon 326 of 363 | NP_001254479.2 | Q8WZ42-12 | ||
| TTN | c.76082_76105delGCTGCCAAATAAGCAACTACATTG | p.Gly25361_Ile25368del | disruptive_inframe_deletion | Exon 276 of 313 | NP_001243779.1 | Q8WZ42-1 | |||
| TTN | c.73301_73324delGCTGCCAAATAAGCAACTACATTG | p.Gly24434_Ile24441del | disruptive_inframe_deletion | Exon 275 of 312 | NP_596869.4 | Q8WZ42-11 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TTN | TSL:5 MANE Select | c.81005_81028delGCTGCCAAATAAGCAACTACATTG | p.Gly27002_Ile27009del | disruptive_inframe_deletion | Exon 326 of 363 | ENSP00000467141.1 | Q8WZ42-12 | ||
| TTN | TSL:1 | c.80849_80872delGCTGCCAAATAAGCAACTACATTG | p.Gly26950_Ile26957del | disruptive_inframe_deletion | Exon 324 of 361 | ENSP00000408004.2 | A0A1B0GXE3 | ||
| TTN | TSL:1 | c.80729_80752delGCTGCCAAATAAGCAACTACATTG | p.Gly26910_Ile26917del | disruptive_inframe_deletion | Exon 324 of 361 | ENSP00000405517.2 | A0A0C4DG59 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.