rs727504756

Positions:

• chr2-178565103-ACAATGTAGTTGCTTATTTGGCAGC-A

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_001267550.2(TTN):​c.81005_81028delGCTGCCAAATAAGCAACTACATTG​(p.Gly27002_Ile27009del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TTN NM_001267550.2 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 9.27

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001267550.2.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TTN	NM_001267550.2	c.81005_81028delGCTGCCAAATAAGCAACTACATTG	p.Gly27002_Ile27009del	disruptive_inframe_deletion	326/363	ENST00000589042.5	NP_001254479.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TTN	ENST00000589042.5	c.81005_81028delGCTGCCAAATAAGCAACTACATTG	p.Gly27002_Ile27009del	disruptive_inframe_deletion	326/363	5	NM_001267550.2	ENSP00000467141.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000378

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Apr 20, 2020

The p.Gly24434_Ile24441del variant in TTN has been identified by our laboratory in 1 individual with DCM, 1 child referred for cardiomyopathy genetic testing with no clinical information provided, and segregated with disease in 1 affected relative. This variant has also been reported by other clinical laboratories in ClinVar (Variation ID: 179275) and was absent from large population studies. This variant is a deletion of 8 amino acids beginning at position 24434 and is not predicted to alter the protein reading-frame. It is unclear if this deletion will impact the protein. In summary, the clinical significance of the p.Gly24434_Ile24441del variant is uncertain. ACMG/AMP Criteria applied: PM2, PM4. -

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Apr 21, 2018

A variant of uncertain significance has been identified in the TTN gene. The c.76082_76105del24 variant has not been published as pathogenic or been reported as benign to our knowledge. The c.76082_76105del24 variant is not observed in large population cohorts (Lek et al., 2016). The c.76082_76105del24 variant results in an in-frame deletion of eight amino acids, denoted p.Gly25361_Ile25368del. However, in the absence of functional studies, the physiological consequence of this variant cannot be precisely determined. -

Cardiovascular phenotype Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

Apr 17, 2024

The c.53810_53833del24 variant (also known as p.G17937_I17944del) is located in coding exon 153 of the TTN gene. This variant results from an in-frame GCTGCCAAATAAGCAACTACATTG deletion at nucleotide positions 53810 to 53833. This results in the in-frame deletion of 8 residues (GCQISNYI) at codons 17937 to 17944. This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs727504756; hg19: chr2-179429830;