rs730880342

Variant names:

• chr12-25250767-G-GGAGCCGCTGAGCCTCTGGCC
• rs730880342
• NM_004985.5:c.-48_-29dupGGCCAGAGGCTCAGCGGCTC

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_004985.5(KRAS):​c.-48_-29dupGGCCAGAGGCTCAGCGGCTC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000594 in 201,926 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.00058 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00064 (0 hom.)
• Consequence: KRAS NM_004985.5 5_prime_UTR
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 0.671

Genes affected

KRAS (HGNC:6407): (KRAS proto-oncogene, GTPase) This gene, a Kirsten ras oncogene homolog from the mammalian ras gene family, encodes a protein that is a member of the small GTPase superfamily. A single amino acid substitution is responsible for an activating mutation. The transforming protein that results is implicated in various malignancies, including lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas and colorectal carcinoma. Alternative splicing leads to variants encoding two isoforms that differ in the C-terminal region. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant 12-25250767-G-GGAGCCGCTGAGCCTCTGGCC is Benign according to our data. Variant chr12-25250767-G-GGAGCCGCTGAGCCTCTGGCC is described in ClinVar as [Likely_benign]. Clinvar id is 177929.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.00058 (88/151840) while in subpopulation NFE AF= 0.00109 (74/67906). AF 95% confidence interval is 0.00089. There are 0 homozygotes in gnomad4. There are 41 alleles in male gnomad4 subpopulation. Median coverage is 32. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 88 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KRAS	NM_004985.5	c.-48_-29dupGGCCAGAGGCTCAGCGGCTC		5_prime_UTR_variant	Exon 1 of 5	ENST00000311936.8	NP_004976.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KRAS	ENST00000311936.8	c.-48_-29dupGGCCAGAGGCTCAGCGGCTC		5_prime_UTR_variant	Exon 1 of 5	1	NM_004985.5	ENSP00000308495.3

Frequencies

GnomAD3 genomes AF: 0.000580 AC: 88 AN: 151840 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000242

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000197

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00109

Gnomad OTH AF: 0.000479

GnomAD4 exome AF: 0.000639 AC: 32 AN: 50086 Hom.: 0 Cov.: 0 AF XY: 0.000654 AC XY: 16 AN XY: 24466

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000978

Gnomad4 OTH exome AF: 0.000524

GnomAD4 genome AF: 0.000580 AC: 88 AN: 151840 Hom.: 0 Cov.: 32 AF XY: 0.000553 AC XY: 41 AN XY: 74166

Gnomad4 AFR AF: 0.000242

Gnomad4 AMR AF: 0.000197

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00109

Gnomad4 OTH AF: 0.000479

Alfa AF: 0.000843 Hom.: 0

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

May 17, 2012

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

-48_-29dup in the 5'UTR of exon 1 of KRAS: The -48_-29dup variant in the KRAS 5' UTR has not been previously reported in the literature. We have identified this variant in one proband and a reportedly unaffected parent in our laboratory. Th e 5' UTR plays a role in the regulation of gene expression and variants in this region have been shown to alter protein translation (Mendell 2001, Scheper 2007) . This type of variant has not been previously reported in an individual with a Noonan spectrum disorder. -

not provided Benign:1

Oct 23, 2015

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs730880342; hg19: chr12-25403701;