rs730880342
Variant summary
Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_StrongBS1BS2
The NM_004985.5(KRAS):c.-48_-29dupGGCCAGAGGCTCAGCGGCTC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000594 in 201,926 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_004985.5 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- cardiofaciocutaneous syndrome 2Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- Noonan syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- Noonan syndrome 3Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp, G2P
- cardiofaciocutaneous syndromeInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen
- linear nevus sebaceous syndromeInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- Costello syndromeInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- Noonan syndrome with multiple lentiginesInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- Noonan syndrome-like disorder with loose anagen hairInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004985.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KRAS | MANE Plus Clinical | c.-48_-29dupGGCCAGAGGCTCAGCGGCTC | 5_prime_UTR | Exon 1 of 6 | NP_203524.1 | P01116-1 | |||
| KRAS | MANE Select | c.-48_-29dupGGCCAGAGGCTCAGCGGCTC | 5_prime_UTR | Exon 1 of 5 | NP_004976.2 | ||||
| KRAS | c.-35_-16dupGGCCAGAGGCTCAGCGGCTC | 5_prime_UTR | Exon 1 of 6 | NP_001356715.1 | P01116-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KRAS | TSL:1 MANE Plus Clinical | c.-48_-29dupGGCCAGAGGCTCAGCGGCTC | 5_prime_UTR | Exon 1 of 6 | ENSP00000256078.5 | P01116-1 | |||
| KRAS | TSL:1 MANE Select | c.-48_-29dupGGCCAGAGGCTCAGCGGCTC | 5_prime_UTR | Exon 1 of 5 | ENSP00000308495.3 | P01116-2 | |||
| KRAS | TSL:1 | c.-48_-29dupGGCCAGAGGCTCAGCGGCTC | 5_prime_UTR | Exon 1 of 3 | ENSP00000451856.1 | G3V4K2 |
Frequencies
GnomAD3 genomes AF: 0.000580 AC: 88AN: 151840Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 0.000639 AC: 32AN: 50086Hom.: 0 Cov.: 0 AF XY: 0.000654 AC XY: 16AN XY: 24466 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000580 AC: 88AN: 151840Hom.: 0 Cov.: 32 AF XY: 0.000553 AC XY: 41AN XY: 74166 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at