rs730882228

Variant names:

• chr5-169604101-GAAAAGAAACTTCAAGCAAATTGGA-G
• rs730882228
• NM_017785.5:c.1724_1747delCAAGCAAATTGGAAAAAGAAACTT

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_017785.5(SPDL1):​c.1724_1747delCAAGCAAATTGGAAAAAGAAACTT​(p.Ser575_Thr582del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000479 in 1,460,780 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000048 (0 hom.)
• Consequence: SPDL1 NM_017785.5 disruptive_inframe_deletion
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 5.40
• Publications: 0 publications found

Genes affected

SPDL1 (HGNC:26010): (spindle apparatus coiled-coil protein 1) This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]

SPDL1 Gene-Disease associations (from GenCC):

• microcephaly

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_017785.5.
• PP5: Variant 5-169604101-GAAAAGAAACTTCAAGCAAATTGGA-G is Pathogenic according to our data. Variant chr5-169604101-GAAAAGAAACTTCAAGCAAATTGGA-G is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 183325.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_017785.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPDL1	NM_017785.5	MANE Select	c.1724_1747delCAAGCAAATTGGAAAAAGAAACTT	p.Ser575_Thr582del	disruptive_inframe_deletion	Exon 12 of 12	NP_060255.3
	SPDL1	NM_001329641.2		c.1724_1747delCAAGCAAATTGGAAAAAGAAACTT	p.Ser575_Thr582del	disruptive_inframe_deletion	Exon 12 of 12	NP_001316570.1
	SPDL1	NM_001329643.2		c.1511_1534delCAAGCAAATTGGAAAAAGAAACTT	p.Ser504_Thr511del	disruptive_inframe_deletion	Exon 13 of 13	NP_001316572.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPDL1	ENST00000265295.9	TSL:1 MANE Select	c.1724_1747delCAAGCAAATTGGAAAAAGAAACTT	p.Ser575_Thr582del	disruptive_inframe_deletion	Exon 12 of 12	ENSP00000265295.4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000479 AC: 7 AN: 1460780 Hom.: 0 AF XY: 0.00000413 AC XY: 3 AN XY: 726704

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000300 AC: 1 AN: 33368

American (AMR) AF: 0.00 AC: 0 AN: 44552

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26086

East Asian (EAS) AF: 0.00 AC: 0 AN: 39622

South Asian (SAS) AF: 0.00 AC: 0 AN: 86074

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53390

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5752

European-Non Finnish (NFE) AF: 0.00000540 AC: 6 AN: 1111590

Other (OTH) AF: 0.00 AC: 0 AN: 60346

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000000891741), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Neonatal death;CN228308:Severe primary microcephaly Pathogenic:1

Dec 01, 2014

Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: research

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.4
Mutation Taster		=42/158	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs730882228; hg19: chr5-169031105;