rs74315130

Variant names:

• chr16-16182884-GACCGACAACAGCCAGCAGACAGC-G
• rs74315130
• NM_001171.6:c.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001171.6(ABCC6):​c.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT​(p.Gly656AlafsTer77) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ABCC6 NM_001171.6 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 9.32

Genes affected

ABCC6 (HGNC:57): (ATP binding cassette subfamily C member 6) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 16-16182884-GACCGACAACAGCCAGCAGACAGC-G is Pathogenic according to our data. Variant chr16-16182884-GACCGACAACAGCCAGCAGACAGC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 433251.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ABCC6	NM_001171.6	c.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT	p.Gly656AlafsTer77	frameshift_variant	Exon 16 of 31	ENST00000205557.12	NP_001162.5
ABCC6	NM_001351800.1	c.1625_1647delGCTGTCTGCTGGCTGTTGTCGGT	p.Gly542AlafsTer77	frameshift_variant	Exon 16 of 31		NP_001338729.1
ABCC6	NR_147784.1	n.2004_2026delGCTGTCTGCTGGCTGTTGTCGGT		non_coding_transcript_exon_variant	Exon 16 of 29

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ABCC6	ENST00000205557.12	c.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT	p.Gly656AlafsTer77	frameshift_variant	Exon 16 of 31	1	NM_001171.6	ENSP00000205557.7
ABCC6	ENST00000456970.6	n.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT		non_coding_transcript_exon_variant	Exon 16 of 29	2		ENSP00000405002.2
ABCC6	ENST00000622290.5	n.1967_1989delGCTGTCTGCTGGCTGTTGTCGGT		non_coding_transcript_exon_variant	Exon 16 of 32	5		ENSP00000483331.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Autosomal recessive inherited pseudoxanthoma elasticum Pathogenic:2

Mar 02, 2021

PXE International

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

Apr 01, 2006

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs74315130; hg19: chr16-16276741;