rs745495583
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_178452.6(DNAAF1):c.1300_1322delGGAGATGGAGAGCCAGAGGGGAC(p.Gly434ProfsTer4) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000173 in 1,582,856 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G434G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_178452.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- primary ciliary dyskinesia 13Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Labcorp Genetics (formerly Invitae)
- primary ciliary dyskinesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_178452.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DNAAF1 | TSL:1 MANE Select | c.1300_1322delGGAGATGGAGAGCCAGAGGGGAC | p.Gly434ProfsTer4 | frameshift | Exon 8 of 12 | ENSP00000367815.5 | Q8NEP3-1 | ||
| DNAAF1 | c.1300_1322delGGAGATGGAGAGCCAGAGGGGAC | p.Gly434ProfsTer4 | frameshift | Exon 8 of 13 | ENSP00000633756.1 | ||||
| DNAAF1 | c.1300_1322delGGAGATGGAGAGCCAGAGGGGAC | p.Gly434ProfsTer4 | frameshift | Exon 8 of 13 | ENSP00000633753.1 |
Frequencies
GnomAD3 genomes AF: 0.0000527 AC: 8AN: 151692Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000239 AC: 6AN: 251330 AF XY: 0.0000147 show subpopulations
GnomAD4 exome AF: 0.000186 AC: 266AN: 1431164Hom.: 0 AF XY: 0.000166 AC XY: 118AN XY: 711350 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000527 AC: 8AN: 151692Hom.: 0 Cov.: 32 AF XY: 0.0000675 AC XY: 5AN XY: 74094 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at