rs745495583

Variant names:

• chr16-84170123-AGGACGGAGATGGAGAGCCAGAGG-A
• rs745495583
• NM_178452.6:c.1300_1322delGGAGATGGAGAGCCAGAGGGGAC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_178452.6(DNAAF1):​c.1300_1322delGGAGATGGAGAGCCAGAGGGGAC​(p.Gly434ProfsTer4) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000173 in 1,582,856 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G434G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000053 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00019 (0 hom.)
• Consequence: DNAAF1 NM_178452.6 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 1.03
• Publications: 1 publications found

Genes affected

DNAAF1 (HGNC:30539): (dynein axonemal assembly factor 1) The protein encoded by this gene is cilium-specific and is required for the stability of the ciliary architecture. It is involved in the regulation of microtubule-based cilia and actin-based brush border microvilli. Mutations in this gene are associated with primary ciliary dyskinesia-13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

DNAAF1 Gene-Disease associations (from GenCC):

• primary ciliary dyskinesia 13

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Labcorp Genetics (formerly Invitae)
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-84170123-AGGACGGAGATGGAGAGCCAGAGG-A is Pathogenic according to our data. Variant chr16-84170123-AGGACGGAGATGGAGAGCCAGAGG-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 525404.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_178452.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DNAAF1	NM_178452.6	MANE Select	c.1300_1322delGGAGATGGAGAGCCAGAGGGGAC	p.Gly434ProfsTer4	frameshift	Exon 8 of 12	NP_848547.4
	DNAAF1	NM_001318756.1		c.592_614delGGAGATGGAGAGCCAGAGGGGAC	p.Gly198ProfsTer4	frameshift	Exon 4 of 8	NP_001305685.1	Q8NEP3-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DNAAF1	ENST00000378553.10	TSL:1 MANE Select	c.1300_1322delGGAGATGGAGAGCCAGAGGGGAC	p.Gly434ProfsTer4	frameshift	Exon 8 of 12	ENSP00000367815.5	Q8NEP3-1
	DNAAF1	ENST00000963697.1		c.1300_1322delGGAGATGGAGAGCCAGAGGGGAC	p.Gly434ProfsTer4	frameshift	Exon 8 of 13	ENSP00000633756.1
	DNAAF1	ENST00000963694.1		c.1300_1322delGGAGATGGAGAGCCAGAGGGGAC	p.Gly434ProfsTer4	frameshift	Exon 8 of 13	ENSP00000633753.1

Frequencies

GnomAD3 genomes AF: 0.0000527 AC: 8 AN: 151692 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000118

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000239 AC: 6 AN: 251330 AF XY: 0.0000147

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000528

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000186 AC: 266 AN: 1431164 Hom.: 0 AF XY: 0.000166 AC XY: 118 AN XY: 711350

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32758

American (AMR) AF: 0.00 AC: 0 AN: 43438

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24796

East Asian (EAS) AF: 0.00 AC: 0 AN: 36814

South Asian (SAS) AF: 0.00 AC: 0 AN: 83274

European-Finnish (FIN) AF: 0.0000189 AC: 1 AN: 52878

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5484

European-Non Finnish (NFE) AF: 0.000238 AC: 260 AN: 1093172

Other (OTH) AF: 0.0000854 AC: 5 AN: 58550

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000527 AC: 8 AN: 151692 Hom.: 0 Cov.: 32 AF XY: 0.0000675 AC XY: 5 AN XY: 74094

African (AFR) AF: 0.00 AC: 0 AN: 41228

American (AMR) AF: 0.00 AC: 0 AN: 15246

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5166

South Asian (SAS) AF: 0.00 AC: 0 AN: 4792

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10562

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.000118 AC: 8 AN: 67928

Other (OTH) AF: 0.00 AC: 0 AN: 2080

Alfa AF: 0.0000868 Hom.: 0

Bravo AF: 0.0000567

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Primary ciliary dyskinesia (2)
1	-	-	DNAAF1-related disorder (1)
1	-	-	not provided (1)
1	-	-	Primary ciliary dyskinesia 13 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.0
Mutation Taster		=33/167	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs745495583; hg19: chr16-84203729;