rs746113335

Variant names:

• chr1-204190474-A-ACCTGCGCCCTCAGCCCCGCC
• rs746113335
• NM_002256.4:c.407_*9dupGGCGGGGCTGAGGGCGCAGG

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BS1 BS2

The NM_002256.4(KISS1):​c.407_*9dupGGCGGGGCTGAGGGCGCAGG variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00202 in 1,501,544 control chromosomes in the GnomAD database, including 55 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.012 (27 hom., cov: 29)
  • Exomes 𝑓: 0.0011 (28 hom.)
• Consequence: KISS1 NM_002256.4 3_prime_UTR
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: -3.68
• Publications: 1 publications found

Genes affected

KISS1 (HGNC:6341): (KiSS-1 metastasis suppressor) This gene is a metastasis suppressor gene that suppresses metastases of melanomas and breast carcinomas without affecting tumorigenicity. The encoded protein may inhibit chemotaxis and invasion and thereby attenuate metastasis in malignant melanomas. Studies suggest a putative role in the regulation of events downstream of cell-matrix adhesion, perhaps involving cytoskeletal reorganization. A protein product of this gene, kisspeptin, stimulates gonadotropin-releasing hormone (GnRH)-induced gonadotropin secretion and regulates the pubertal activation of GnRH neurons. A polymorphism in the terminal exon of this mRNA results in two protein isoforms. An adenosine present at the polymorphic site represents the third position in a stop codon. When the adenosine is absent, a downstream stop codon is utilized and the encoded protein extends for an additional seven amino acid residues. [provided by RefSeq, Jun 2022]

REN (HGNC:9958): (renin) This gene encodes renin, an aspartic protease that is secreted by the kidneys. Renin is a part of the renin-angiotensin-aldosterone system involved in regulation of blood pressure, and electrolyte balance. This enzyme catalyzes the first step in the activation pathway of angiotensinogen by cleaving angiotensinogen to form angiotensin I, which is then converted to angiotensin II by angiotensin I converting enzyme. This cascade can result in aldosterone release, narrowing of blood vessels, and increase in blood pressure as angiotension II is a vasoconstrictive peptide. Transcript variants that encode different protein isoforms and that arise from alternative splicing and the use of alternative promoters have been described, but their full-length nature has not been determined. Mutations in this gene have been shown to cause hyperuricemic nephropathy familial juvenile 2, familial hyperproreninemia, and renal tubular dysgenesis. [provided by RefSeq, May 2020]

REN Gene-Disease associations (from GenCC):

• familial juvenile hyperuricemic nephropathy type 2

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• renal tubular dysgenesis of genetic origin

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet, ClinGen

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 1-204190474-A-ACCTGCGCCCTCAGCCCCGCC is Benign according to our data. Variant chr1-204190474-A-ACCTGCGCCCTCAGCCCCGCC is described in ClinVar as Benign. ClinVar VariationId is 1226970.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.0117 (1466/125460) while in subpopulation AFR AF = 0.0437 (1393/31862). AF 95% confidence interval is 0.0418. There are 27 homozygotes in GnomAd4. There are 672 alleles in the male GnomAd4 subpopulation. Median coverage is 29. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 27 AR,AD gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002256.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KISS1	NM_002256.4	MANE Select	c.407_*9dupGGCGGGGCTGAGGGCGCAGG		3_prime_UTR	Exon 3 of 3	NP_002247.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KISS1	ENST00000367194.5	TSL:1 MANE Select	c.407_*9dupGGCGGGGCTGAGGGCGCAGG		3_prime_UTR	Exon 3 of 3	ENSP00000356162.4	Q15726
	KISS1	ENST00000882445.1		c.407_*9dupGGCGGGGCTGAGGGCGCAGG		3_prime_UTR	Exon 2 of 2	ENSP00000552504.1
	REN	ENST00000638118.1	TSL:5	c.-473_-454dupGGCGGGGCTGAGGGCGCAGG		upstream_gene	N/A	ENSP00000490307.1	A0A1B0GUZ2

Frequencies

GnomAD3 genomes AF: 0.0116 AC: 1457 AN: 125406 Hom.: 27 Cov.: 29

Gnomad AFR AF: 0.0435

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00439

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000260

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00385

Gnomad NFE AF: 0.0000832

Gnomad OTH AF: 0.00745

GnomAD2 exomes AF: 0.00193 AC: 375 AN: 194492 AF XY: 0.00150

Gnomad AFR exome AF: 0.0278

Gnomad AMR exome AF: 0.00132

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000141

Gnomad OTH exome AF: 0.000617

GnomAD4 exome AF: 0.00114 AC: 1573 AN: 1376084 Hom.: 28 Cov.: 34 AF XY: 0.00100 AC XY: 686 AN XY: 683156

African (AFR) AF: 0.0447 AC: 1262 AN: 28254

American (AMR) AF: 0.00153 AC: 64 AN: 41764

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23020

East Asian (EAS) AF: 0.00 AC: 0 AN: 36266

South Asian (SAS) AF: 0.000240 AC: 20 AN: 83378

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 43422

Middle Eastern (MID) AF: 0.00178 AC: 7 AN: 3936

European-Non Finnish (NFE) AF: 0.0000612 AC: 65 AN: 1061578

Other (OTH) AF: 0.00285 AC: 155 AN: 54466

GnomAD4 genome AF: 0.0117 AC: 1466 AN: 125460 Hom.: 27 Cov.: 29 AF XY: 0.0111 AC XY: 672 AN XY: 60758

African (AFR) AF: 0.0437 AC: 1393 AN: 31862

American (AMR) AF: 0.00438 AC: 53 AN: 12100

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3094

East Asian (EAS) AF: 0.00 AC: 0 AN: 3448

South Asian (SAS) AF: 0.000261 AC: 1 AN: 3834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 8172

Middle Eastern (MID) AF: 0.00420 AC: 1 AN: 238

European-Non Finnish (NFE) AF: 0.0000832 AC: 5 AN: 60110

Other (OTH) AF: 0.00737 AC: 13 AN: 1764

Alfa AF: 0.00467 Hom.: 1

Asia WGS AF: 0.00304 AC: 10 AN: 3306

ClinVar

ClinVar submissions as Germline

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-3.7
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs746113335; hg19: chr1-204159602; COSMIC: COSV65817123; COSMIC: COSV65817123;