rs749390209

Variant names:

• chr20-59301498-AGAGACTGTGGCTGGCCCTGGCGAG-A
• rs749390209
• NM_207034.3:c.167_190delAGACTGTGGCTGGCCCTGGCGAGG

Your query was ambiguous. Multiple possible variants found:

• chr20-59301498-AGAGACTGTGGCTGGCCCTGGCGAG-A
• chr20-59301498-AGAGACTGTGGCTGGCCCTGGCGAG-AGAGACTGTGGCTGGCCCTGGCGAGGAGACTGTGGCTGGCCCTGGCGAG

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 2P and 8B. PM4 BP6_Very_Strong

The NM_207034.3(EDN3):​c.167_190delAGACTGTGGCTGGCCCTGGCGAGG​(p.Glu56_Glu63del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000213 in 1,613,646 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.00072 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00016 (0 hom.)
• Consequence: EDN3 NM_207034.3 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 0.0640
• Publications: 0 publications found

Genes affected

EDN3 (HGNC:3178): (endothelin 3) The protein encoded by this gene is a member of the endothelin family. Endothelins are endothelium-derived vasoactive peptides involved in a variety of biological functions. The active form of this protein is a 21 amino acid peptide processed from the precursor protein. The active peptide is a ligand for endothelin receptor type B (EDNRB). The interaction of this endothelin with EDNRB is essential for development of neural crest-derived cell lineages, such as melanocytes and enteric neurons. Mutations in this gene and EDNRB have been associated with Hirschsprung disease (HSCR) and Waardenburg syndrome (WS), which are congenital disorders involving neural crest-derived cells. Altered expression of this gene is implicated in tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]

EDN3 Gene-Disease associations (from GenCC):

• Waardenburg syndrome type 4B

  Inheritance: AD, AR, SD Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, G2P
• Waardenburg syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
• Waardenburg-Shah syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Hirschsprung disease, susceptibility to, 4

  Inheritance: Unknown, AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_207034.3.
• BP6: Variant 20-59301498-AGAGACTGTGGCTGGCCCTGGCGAG-A is Benign according to our data. Variant chr20-59301498-AGAGACTGTGGCTGGCCCTGGCGAG-A is described in ClinVar as Likely_benign. ClinVar VariationId is 504086.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_207034.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EDN3	NM_207034.3	MANE Select	c.167_190delAGACTGTGGCTGGCCCTGGCGAGG	p.Glu56_Glu63del	disruptive_inframe_deletion	Exon 2 of 5	NP_996917.1	P14138-1
	EDN3	NM_001424362.1		c.167_190delAGACTGTGGCTGGCCCTGGCGAGG	p.Glu56_Glu63del	disruptive_inframe_deletion	Exon 2 of 5	NP_001411291.1
	EDN3	NM_207033.3		c.167_190delAGACTGTGGCTGGCCCTGGCGAGG	p.Glu56_Glu63del	disruptive_inframe_deletion	Exon 2 of 4	NP_996916.1	P14138-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EDN3	ENST00000337938.7	TSL:1 MANE Select	c.167_190delAGACTGTGGCTGGCCCTGGCGAGG	p.Glu56_Glu63del	disruptive_inframe_deletion	Exon 2 of 5	ENSP00000337128.2	P14138-1
	EDN3	ENST00000395654.3	TSL:1	c.167_190delAGACTGTGGCTGGCCCTGGCGAGG	p.Glu56_Glu63del	disruptive_inframe_deletion	Exon 2 of 4	ENSP00000379015.3	P14138-2
	EDN3	ENST00000311585.11	TSL:1	c.167_190delAGACTGTGGCTGGCCCTGGCGAGG	p.Glu56_Glu63del	disruptive_inframe_deletion	Exon 2 of 5	ENSP00000311854.7	P14138-3

Frequencies

GnomAD3 genomes AF: 0.000717 AC: 109 AN: 152028 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00215

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000661

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000177

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000257 AC: 64 AN: 249414 AF XY: 0.000192

Gnomad AFR exome AF: 0.00213

Gnomad AMR exome AF: 0.000232

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000544

Gnomad FIN exome AF: 0.000371

Gnomad NFE exome AF: 0.0000802

Gnomad OTH exome AF: 0.000164

GnomAD4 exome AF: 0.000160 AC: 234 AN: 1461502 Hom.: 0 AF XY: 0.000142 AC XY: 103 AN XY: 727078

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00194 AC: 65 AN: 33466

American (AMR) AF: 0.000246 AC: 11 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26130

East Asian (EAS) AF: 0.000302 AC: 12 AN: 39700

South Asian (SAS) AF: 0.000209 AC: 18 AN: 86256

European-Finnish (FIN) AF: 0.000452 AC: 24 AN: 53102

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000818 AC: 91 AN: 1111976

Other (OTH) AF: 0.000215 AC: 13 AN: 60384

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000716 AC: 109 AN: 152144 Hom.: 0 Cov.: 32 AF XY: 0.000807 AC XY: 60 AN XY: 74388

African (AFR) AF: 0.00214 AC: 89 AN: 41502

American (AMR) AF: 0.0000654 AC: 1 AN: 15296

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5156

South Asian (SAS) AF: 0.00 AC: 0 AN: 4820

European-Finnish (FIN) AF: 0.000661 AC: 7 AN: 10598

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.000177 AC: 12 AN: 67980

Other (OTH) AF: 0.00 AC: 0 AN: 2114

Alfa AF: 0.000174 Hom.: 0

Bravo AF: 0.000654

EpiCase AF: 0.000273

EpiControl AF: 0.000178

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	EDN3-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.064
Mutation Taster		=155/45	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs749390209; hg19: chr20-57876553; COSMIC: COSV108849877;