rs749694145

Variant names:

• chr5-61332326-GGGCGGCGGCGGCGGCGGCGGGGGCAGCAGCGGCGGC-G
• NM_020928.2:c.65_100delGCGGCGGCGGGGGCAGCAGCGGCGGCGGCGGCGGCG

Your query was ambiguous. Multiple possible variants found:

• chr5-61332326-GGGCGGCGGCGGCGGCGGCGGGGGCAGCAGCGGCGGC-G
• chr5-61332326-GGGCGGCGGCGGCGGCGGCGGGGGCAGCAGCGGCGGC-GGGC
• chr5-61332326-GGGCGGCGGCGGCGGCGGCGGGGGCAGCAGCGGCGGC-GGGCGGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_020928.2(ZSWIM6):​c.65_100delGCGGCGGCGGGGGCAGCAGCGGCGGCGGCGGCGGCG​(p.Gly22_Gly33del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000206 in 969,394 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 26)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: ZSWIM6 NM_020928.2 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.15

Genes affected

ZSWIM6 (HGNC:29316): (zinc finger SWIM-type containing 6) The protein encoded by this gene contains a zinc finger SWI2/SNF2 and MuDR (SWIM) domain. Proteins with SWIM domains have been found in a diverse number of species and are predicted to interact with DNA or proteins. Mutations in this gene result in acromelic frontonasal dysostosis. [provided by RefSeq, Apr 2017]

LOC105378994 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ZSWIM6	NM_020928.2	c.65_100delGCGGCGGCGGGGGCAGCAGCGGCGGCGGCGGCGGCG	p.Gly22_Gly33del	disruptive_inframe_deletion	Exon 1 of 14	ENST00000252744.6	NP_065979.1
LOC105378994	XR_007058781.1	n.-146_-111delGCCGCCGCTGCTGCCCCCGCCGCCGCCGCCGCCGCC		upstream_gene_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ZSWIM6	ENST00000252744.6	c.65_100delGCGGCGGCGGGGGCAGCAGCGGCGGCGGCGGCGGCG	p.Gly22_Gly33del	disruptive_inframe_deletion	Exon 1 of 14	5	NM_020928.2	ENSP00000252744.5

Frequencies

GnomAD3 genomes Cov.: 26

GnomAD4 exome AF: 0.00000206 AC: 2 AN: 969394 Hom.: 0 AF XY: 0.00000219 AC XY: 1 AN XY: 457600

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000108

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 26

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-60628153;