rs749710849

Positions:

• chr15-89776891-GGGGCAGGGGCAAGGGCAGGGGCAGGGGCAGGGGCAA-G

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_001039958.2(MESP2):​c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG​(p.Gln184_Gly195del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0089 (2 hom., cov: 0)
  • Exomes 𝑓: 0.019 (29 hom.)
  • Failed GnomAD Quality Control
• Consequence: MESP2 NM_001039958.2 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 0.806

Genes affected

MESP2 (HGNC:29659): (mesoderm posterior bHLH transcription factor 2) This gene encodes a member of the bHLH family of transcription factors and plays a key role in defining the rostrocaudal patterning of somites via interactions with multiple Notch signaling pathways. This gene is expressed in the anterior presomitic mesoderm and is downregulated immediately after the formation of segmented somites. This gene also plays a role in the formation of epithelial somitic mesoderm and cardiac mesoderm. Mutations in the MESP2 gene cause autosomal recessive spondylocostal dystosis 2 (SCD02). [provided by RefSeq, Oct 2008]

MESP2 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant 15-89776891-GGGGCAGGGGCAAGGGCAGGGGCAGGGGCAGGGGCAA-G is Benign according to our data. Variant chr15-89776891-GGGGCAGGGGCAAGGGCAGGGGCAGGGGCAGGGGCAA-G is described in ClinVar as [Likely_benign]. Clinvar id is 257242.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr15-89776891-GGGGCAGGGGCAAGGGCAGGGGCAGGGGCAGGGGCAA-G is described in Lovd as [Likely_benign].
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.00894 (534/59704) while in subpopulation NFE AF= 0.0196 (452/23014). AF 95% confidence interval is 0.0181. There are 2 homozygotes in gnomad4. There are 226 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 2 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MESP2	NM_001039958.2	c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG	p.Gln184_Gly195del	disruptive_inframe_deletion	1/2	ENST00000341735.5	NP_001035047.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MESP2	ENST00000341735.5	c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG	p.Gln184_Gly195del	disruptive_inframe_deletion	1/2	1	NM_001039958.2	ENSP00000342392.3
MESP2	ENST00000560219.2	c.31-1159_31-1124delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG		intron_variant		1		ENSP00000452998.1
MESP2	ENST00000558723.1	n.39-1159_39-1124delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG		intron_variant		3

Frequencies

GnomAD3 genomes AF: 0.00895 AC: 534 AN: 59648 Hom.: 2 Cov.: 0

Gnomad AFR AF: 0.00173

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00302

Gnomad ASJ AF: 0.000885

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0108

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0196

Gnomad OTH AF: 0.00266

GnomAD3 exomes AF: 0.00430 AC: 305 AN: 70850 Hom.: 2 AF XY: 0.00470 AC XY: 179 AN XY: 38090

Gnomad AFR exome AF: 0.00135

Gnomad AMR exome AF: 0.000894

Gnomad ASJ exome AF: 0.000513

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000232

Gnomad FIN exome AF: 0.00364

Gnomad NFE exome AF: 0.00892

Gnomad OTH exome AF: 0.00271

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0189 AC: 8142 AN: 431272 Hom.: 29 AF XY: 0.0181 AC XY: 3814 AN XY: 211190

Gnomad4 AFR exome AF: 0.00150

Gnomad4 AMR exome AF: 0.00340

Gnomad4 ASJ exome AF: 0.000466

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000123

Gnomad4 FIN exome AF: 0.0169

Gnomad4 NFE exome AF: 0.0222

Gnomad4 OTH exome AF: 0.0104

GnomAD4 genome AF: 0.00894 AC: 534 AN: 59704 Hom.: 2 Cov.: 0 AF XY: 0.00796 AC XY: 226 AN XY: 28394

Gnomad4 AFR AF: 0.00173

Gnomad4 AMR AF: 0.00302

Gnomad4 ASJ AF: 0.000885

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.0108

Gnomad4 NFE AF: 0.0196

Gnomad4 OTH AF: 0.00264

Alfa AF: 0.00388 Hom.: 0

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Benign, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	May 01, 2023	MESP2: BS1, BS2 -
Likely benign, criteria provided, single submitter	clinical testing	Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics	Mar 10, 2017	- -

not specified Benign:1

Benign, criteria provided, single submitter

clinical testing

PreventionGenetics, part of Exact Sciences

-

- -

Spondylocostal dysostosis 2, autosomal recessive Benign:1

Benign, no assertion criteria provided

clinical testing

Natera, Inc.

Sep 25, 2019

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs749710849; hg19: chr15-90320122;