rs749710849

Variant names:

• chr15-89776891-GGGGCAGGGGCAAGGGCAGGGGCAGGGGCAGGGGCAA-G
• rs749710849
• NM_001039958.2:c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_001039958.2(MESP2):​c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG​(p.Gln184_Gly195del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. G183G) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0089 (2 hom., cov: 0)
  • Exomes 𝑓: 0.019 (29 hom.)
  • Failed GnomAD Quality Control
• Consequence: MESP2 NM_001039958.2 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 0.806
• Publications: 1 publications found

Genes affected

MESP2 (HGNC:29659): (mesoderm posterior bHLH transcription factor 2) This gene encodes a member of the bHLH family of transcription factors and plays a key role in defining the rostrocaudal patterning of somites via interactions with multiple Notch signaling pathways. This gene is expressed in the anterior presomitic mesoderm and is downregulated immediately after the formation of segmented somites. This gene also plays a role in the formation of epithelial somitic mesoderm and cardiac mesoderm. Mutations in the MESP2 gene cause autosomal recessive spondylocostal dystosis 2 (SCD02). [provided by RefSeq, Oct 2008]

MESP2 Gene-Disease associations (from GenCC):

• spondylocostal dysostosis 2, autosomal recessive

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• autosomal recessive spondylocostal dysostosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant 15-89776891-GGGGCAGGGGCAAGGGCAGGGGCAGGGGCAGGGGCAA-G is Benign according to our data. Variant chr15-89776891-GGGGCAGGGGCAAGGGCAGGGGCAGGGGCAGGGGCAA-G is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 257242.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.00894 (534/59704) while in subpopulation NFE AF = 0.0196 (452/23014). AF 95% confidence interval is 0.0181. There are 2 homozygotes in GnomAd4. There are 226 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 2 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001039958.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MESP2	NM_001039958.2	MANE Select	c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG	p.Gln184_Gly195del	disruptive_inframe_deletion	Exon 1 of 2	NP_001035047.1	Q0VG99

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MESP2	ENST00000341735.5	TSL:1 MANE Select	c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG	p.Gln184_Gly195del	disruptive_inframe_deletion	Exon 1 of 2	ENSP00000342392.3	Q0VG99
	MESP2	ENST00000560219.2	TSL:1	c.31-1159_31-1124delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG		intron	N/A	ENSP00000452998.1	H0YKZ5
	MESP2	ENST00000558723.1	TSL:3	n.39-1159_39-1124delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.00895 AC: 534 AN: 59648 Hom.: 2 Cov.: 0

Gnomad AFR AF: 0.00173

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00302

Gnomad ASJ AF: 0.000885

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0108

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0196

Gnomad OTH AF: 0.00266

GnomAD2 exomes AF: 0.00430 AC: 305 AN: 70850 AF XY: 0.00470

Gnomad AFR exome AF: 0.00135

Gnomad AMR exome AF: 0.000894

Gnomad ASJ exome AF: 0.000513

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00364

Gnomad NFE exome AF: 0.00892

Gnomad OTH exome AF: 0.00271

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0189 AC: 8142 AN: 431272 Hom.: 29 AF XY: 0.0181 AC XY: 3814 AN XY: 211190

African (AFR) AF: 0.00150 AC: 28 AN: 18612

American (AMR) AF: 0.00340 AC: 13 AN: 3826

Ashkenazi Jewish (ASJ) AF: 0.000466 AC: 3 AN: 6434

East Asian (EAS) AF: 0.00 AC: 0 AN: 1180

South Asian (SAS) AF: 0.000123 AC: 3 AN: 24372

European-Finnish (FIN) AF: 0.0169 AC: 120 AN: 7110

Middle Eastern (MID) AF: 0.000582 AC: 1 AN: 1718

European-Non Finnish (NFE) AF: 0.0222 AC: 7793 AN: 350562

Other (OTH) AF: 0.0104 AC: 181 AN: 17458

GnomAD4 genome AF: 0.00894 AC: 534 AN: 59704 Hom.: 2 Cov.: 0 AF XY: 0.00796 AC XY: 226 AN XY: 28394

African (AFR) AF: 0.00173 AC: 46 AN: 26642

American (AMR) AF: 0.00302 AC: 11 AN: 3644

Ashkenazi Jewish (ASJ) AF: 0.000885 AC: 1 AN: 1130

East Asian (EAS) AF: 0.00 AC: 0 AN: 184

South Asian (SAS) AF: 0.00 AC: 0 AN: 1712

European-Finnish (FIN) AF: 0.0108 AC: 22 AN: 2042

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 100

European-Non Finnish (NFE) AF: 0.0196 AC: 452 AN: 23014

Other (OTH) AF: 0.00264 AC: 2 AN: 758

Alfa AF: 0.00388 Hom.: 0

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	not specified (1)
-	-	1	Spondylocostal dysostosis 2, autosomal recessive (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.81
Mutation Taster		=196/4	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs749710849; hg19: chr15-90320122; COSMIC: COSV59093704;