rs749737706

Variant names:

• chr17-58206552-GGCATGCCATTGGGACAGCCTCAGGTTTCT-G
• rs386834043
• NM_017777.4:c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PM2 PP5_Very_Strong

The NM_017777.4(MKS1):​c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00111 in 1,611,528 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.0012 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0011 (0 hom.)
• Consequence: MKS1 NM_017777.4 splice_region, intron
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:19
• Conservation: PhyloP100: 3.22

Genes affected

MKS1 (HGNC:7121): (MKS transition zone complex subunit 1) The protein encoded by this gene localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in this gene result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-58206552-GGCATGCCATTGGGACAGCCTCAGGTTTCT-G is Pathogenic according to our data. Variant chr17-58206552-GGCATGCCATTGGGACAGCCTCAGGTTTCT-G is described in ClinVar as [Pathogenic]. Clinvar id is 188400.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr17-58206552-GGCATGCCATTGGGACAGCCTCAGGTTTCT-G is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MKS1	NM_017777.4	c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC		splice_region_variant, intron_variant	Intron 15 of 17	ENST00000393119.7	NP_060247.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MKS1	ENST00000393119.7	c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC		splice_region_variant, intron_variant	Intron 15 of 17	1	NM_017777.4	ENSP00000376827.2

Frequencies

GnomAD3 genomes AF: 0.00120 AC: 183 AN: 152122 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000266

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00885

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00113

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.00105 AC: 260 AN: 246468 Hom.: 0 AF XY: 0.000949 AC XY: 127 AN XY: 133848

Gnomad AFR exome AF: 0.000130

Gnomad AMR exome AF: 0.0000580

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00678

Gnomad NFE exome AF: 0.00102

Gnomad OTH exome AF: 0.00149

GnomAD4 exome AF: 0.00110 AC: 1602 AN: 1459406 Hom.: 0 AF XY: 0.00107 AC XY: 779 AN XY: 726056

Gnomad4 AFR exome AF: 0.000149

Gnomad4 AMR exome AF: 0.0000447

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00748

Gnomad4 NFE exome AF: 0.00105

Gnomad4 OTH exome AF: 0.000679

GnomAD4 genome AF: 0.00120 AC: 183 AN: 152122 Hom.: 0 Cov.: 32 AF XY: 0.00141 AC XY: 105 AN XY: 74304

Gnomad4 AFR AF: 0.000266

Gnomad4 AMR AF: 0.0000655

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00885

Gnomad4 NFE AF: 0.00113

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000790 Hom.: 0

Bravo AF: 0.000582

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:19

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Meckel syndrome, type 1 Pathogenic:6

-

Institute of Human Genetics, University Hospital of Duesseldorf

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: not provided

- -

Nov 01, 2007

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Sep 16, 2020

Natera, Inc.

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

-

Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM)

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Dec 24, 2019

Myriad Genetics, Inc.

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

NM_017777.3(MKS1):c.1408-34_1408-6del29 is classified as pathogenic in the context of MKS1-related disorders. Sources cited for classification include the following: PMID 16415886 and 23351400. Classification of NM_017777.3(MKS1):c.1408-34_1408-6del29 is based on the following criteria: This is a well-established pathogenic variant in the literature that has been observed more frequently in patients with clinical diagnoses than in healthy populations. Please note: this variant was assessed in the context of healthy population screening. -

Feb 20, 2023

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: MKS1 c.1408-34_1408-6del29 alters a nucleotide located close to a canonical splice site and therefore could affect mRNA splicing, leading to a significantly altered protein sequence. Several computational tools predict a significant impact on normal splicing: Three predict the variant abolishes a 3 prime acceptor site. However, these predictions have yet to be confirmed by functional studies. The variant allele was found at a frequency of 0.0011 in 246468 control chromosomes. This frequency is not significantly higher than estimated for a pathogenic variant in MKS1 causing Meckel Syndrome Type 1, allowing no conclusion about variant significance. c.1408-34_1408-6del29 has been reported in the literature in individuals affected with Meckel Syndrome Type 1. These data indicate that the variant is likely to be associated with disease. Twelve clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation (pathogenic n=11, VUS n=1). Based on the evidence outlined above, the variant was classified as pathogenic. -

not provided Pathogenic:5

Mar 01, 2024

CeGaT Center for Human Genetics Tuebingen

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

MKS1: PM3:Very Strong, PM2, PP3, PS3:Supporting -

Apr 11, 2017

Eurofins Ntd Llc (ga)

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 29, 2019

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

DNA sequence analysis of the MKS1 gene demonstrated a 29 bp-deletion in intron 15, c.1408-34_1408-6del. This intronic change is a founder mutation in the Finnish population and a known cause of Meckel-Gruber syndrome. It has been reported in the homozygous and compound heterozygous state in multiple affected individuals (PMIDs: 16415886, 17935508, 17397051). Functional studies in an affected individual's fibroblasts have demonstrated that this variant disrupts mRNA splicing leading to a premature stop codon and a truncated or absent protein (PMID: 16415886). -

May 03, 2022

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Described as a founder mutation in the Finnish population and many other European populations (Kyttala et al., 2006; Frank et al., 2007); Published functional studies demonstrate abnormal gene splicing (Kyttala et al., 2006); In silico analysis, which includes splice predictors and evolutionary conservation, supports a deleterious effect; This variant is associated with the following publications: (PMID: 17377820, 23351400, 17437276, 17935508, 16415886, 17397051, 27377014, 29096034) -

Jun 16, 2023

Revvity Omics, Revvity

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Joubert syndrome 28 Pathogenic:2

Apr 08, 2018

Knight Diagnostic Laboratories, Oregon Health and Sciences University

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Nov 29, 2017

Counsyl

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Meckel-Gruber syndrome;C0431399:Familial aplasia of the vermis Pathogenic:1

Jan 06, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change falls in intron 15 of the MKS1 gene. It does not directly change the encoded amino acid sequence of the MKS1 protein. RNA analysis indicates that this variant induces altered splicing and likely disrupts the C-terminus of the protein. This variant is present in population databases (rs749737706, gnomAD 0.7%), and has an allele count higher than expected for a pathogenic variant. This variant has been observed in individual(s) with Meckel-Gruber syndrome (PMID: 16415886, 17377820, 17397051, 17437276, 17935508). It is commonly reported in individuals of Finnish ancestry (PMID: 23351400). ClinVar contains an entry for this variant (Variation ID: 188400). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Studies have shown that this variant results in skipping of exon 16 and introduces a new termination codon (PMID: 16415886). However the mRNA is not expected to undergo nonsense-mediated decay. For these reasons, this variant has been classified as Pathogenic. -

Inborn genetic diseases Pathogenic:1

Jan 26, 2022

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1408-34_1408-6del29 alteration is located in intron 15 of the MKS1 gene. This alteration consists of a deletion of 29 nucleotides at nucleotide position c.1408-34 to c.1408-6. This mutation has been identified in the homozygous state in multiple Meckel syndrome families and is considered a founder mutation in the Finnish population (Kyttälä, 2006). It has also been reported in several other individuals in the homozygous or compound heterozygous state with Meckel syndrome or a MKS1-related ciliopathy (Consugar, 2007; Szymanska, 2012; Bader, 2016). Analysis of fibroblasts from an individual homozygous for this mutation demonstrated aberrant splicing (Kyttälä, 2006). Based on the available evidence, this alteration is classified as pathogenic. -

Bardet-Biedl syndrome 13 Pathogenic:1

Mar 30, 2024

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Bardet-Biedl syndrome 13;C3714506:Meckel syndrome, type 1;C4310705:Joubert syndrome 28 Pathogenic:1

Jan 25, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

MKS1-related disorder Pathogenic:1

Jun 14, 2024

PreventionGenetics, part of Exact Sciences

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The MKS1 c.1408-34_1408-6del29 variant is predicted to result in an intronic deletion. This deletion has been shown to disrupt splicing of MKS1 and cause Meckel-Gruber syndrome in multiple unrelated individuals when found in the homozygous or compound heterozygous states (reported as IVS15-7_35del in Table 1, Kyttala et al. 2006. PubMed ID: 16415886; reported as c.1408-35_1408-7del29, Szymanska et al. 2012. PubMed ID: 23351400). This variant is reported in 0.70% of alleles in individuals of European (Finnish) descent in gnomAD. In ClinVar, this variant is reported as pathogenic (https://www.ncbi.nlm.nih.gov/clinvar/variation/188400/). This variant is interpreted as pathogenic. -

Familial aplasia of the vermis Pathogenic:1

Jun 19, 2016

Universitätsklinikum Salzburg, Universitätskinderklinik

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs386834043; hg19: chr17-56283913;