rs749737706

Variant names:

• chr17-58206552-GGCATGCCATTGGGACAGCCTCAGGTTTCT-G
• rs386834043
• NM_017777.4:c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PP5_Very_Strong

The NM_017777.4(MKS1):​c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00111 in 1,611,528 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.0012 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0011 (0 hom.)
• Consequence: MKS1 NM_017777.4 splice_region, intron
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:20
• Conservation: PhyloP100: 3.22
• Publications: 7 publications found

Genes affected

MKS1 (HGNC:7121): (MKS transition zone complex subunit 1) The protein encoded by this gene localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in this gene result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

MKS1 Gene-Disease associations (from GenCC):

• Bardet-Biedl syndrome 13

  Inheritance: AR, Unknown Classification: DEFINITIVE, STRONG, LIMITED Submitted by: G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• ciliopathy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Meckel syndrome, type 1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Myriad Women’s Health
• Joubert syndrome 28

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• Bardet-Biedl syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Joubert syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Joubert syndrome with ocular defect

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Meckel syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PP5: Variant 17-58206552-GGCATGCCATTGGGACAGCCTCAGGTTTCT-G is Pathogenic according to our data. Variant chr17-58206552-GGCATGCCATTGGGACAGCCTCAGGTTTCT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 188400.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_017777.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MKS1	NM_017777.4	MANE Select	c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC		splice_region intron	N/A	NP_060247.2	Q9NXB0-1
	MKS1	NM_001321269.2		c.1408-201_1408-173delAGAAACCTGAGGCTGTCCCAATGGCATGC		intron	N/A	NP_001308198.1	A0A7I2V2M0
	MKS1	NM_001330397.2		c.1274-201_1274-173delAGAAACCTGAGGCTGTCCCAATGGCATGC		intron	N/A	NP_001317326.1	H0Y2S2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MKS1	ENST00000393119.7	TSL:1 MANE Select	c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC		splice_region intron	N/A	ENSP00000376827.2	Q9NXB0-1
	MKS1	ENST00000537529.7	TSL:1	c.979-34_979-6delAGAAACCTGAGGCTGTCCCAATGGCATGC		splice_region intron	N/A	ENSP00000442096.3	A0A0S2Z5Z2
	MKS1	ENST00000966002.1		c.1441-34_1441-6delAGAAACCTGAGGCTGTCCCAATGGCATGC		splice_region intron	N/A	ENSP00000636061.1

Frequencies

GnomAD3 genomes AF: 0.00120 AC: 183 AN: 152122 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000266

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00885

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00113

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00105 AC: 260 AN: 246468 AF XY: 0.000949

Gnomad AFR exome AF: 0.000130

Gnomad AMR exome AF: 0.0000580

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00678

Gnomad NFE exome AF: 0.00102

Gnomad OTH exome AF: 0.00149

GnomAD4 exome AF: 0.00110 AC: 1602 AN: 1459406 Hom.: 0 AF XY: 0.00107 AC XY: 779 AN XY: 726056

African (AFR) AF: 0.000149 AC: 5 AN: 33474

American (AMR) AF: 0.0000447 AC: 2 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86252

European-Finnish (FIN) AF: 0.00748 AC: 382 AN: 51054

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00105 AC: 1172 AN: 1111930

Other (OTH) AF: 0.000679 AC: 41 AN: 60370

GnomAD4 genome AF: 0.00120 AC: 183 AN: 152122 Hom.: 0 Cov.: 32 AF XY: 0.00141 AC XY: 105 AN XY: 74304

African (AFR) AF: 0.000266 AC: 11 AN: 41430

American (AMR) AF: 0.0000655 AC: 1 AN: 15276

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5194

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00885 AC: 94 AN: 10622

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00113 AC: 77 AN: 67986

Other (OTH) AF: 0.00 AC: 0 AN: 2088

Alfa AF: 0.000790 Hom.: 0

Bravo AF: 0.000582

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
6	-	-	Meckel syndrome, type 1 (6)
5	-	-	not provided (5)
2	-	-	Bardet-Biedl syndrome 13;C3714506:Meckel syndrome, type 1;C4310705:Joubert syndrome 28 (2)
2	-	-	Joubert syndrome 28 (2)
1	-	-	Bardet-Biedl syndrome 13 (1)
1	-	-	Inborn genetic diseases (1)
1	-	-	Joubert syndrome (1)
1	-	-	Meckel-Gruber syndrome;C0431399:Joubert syndrome (1)
1	-	-	MKS1-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.2
Mutation Taster		=13/87	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs386834043; hg19: chr17-56283913;