rs750220830

Variant names:

• chr6-129315822-GGTTTCTCTACATATAATCCTCAA-G
• rs750220830
• NM_000426.4:c.3799_3821delTTCTCTACATATAATCCTCAAGT

Variant summary

Our verdict is Pathogenic. The variant received 20 ACMG points: 20P and 0B. PVS1 PS3 PP5_Very_Strong

The NM_000426.4(LAMA2):​c.3799_3821delTTCTCTACATATAATCCTCAAGT​(p.Phe1267AspfsTer11) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000192 in 1,613,988 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV000330444: Published functional studies demonstrate a damaging effect on LAMA2 expression, leading to complete absence of merosin on muscle staining (PMID:17765811, 20207543)". Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000020 (0 hom.)
• Consequence: LAMA2 NM_000426.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 9.51
• Publications: 2 publications found

Genes affected

LAMA2 (HGNC:6482): (laminin subunit alpha 2) Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]

LAMA2 Gene-Disease associations (from GenCC):

• congenital merosin-deficient muscular dystrophy 1A

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, G2P, Myriad Women’s Health
• LAMA2-related muscular dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• muscular dystrophy, limb-girdle, autosomal recessive 23

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 20 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PS3: PS3 evidence extracted from ClinVar submissions: SCV000330444: Published functional studies demonstrate a damaging effect on LAMA2 expression, leading to complete absence of merosin on muscle staining (PMID: 17765811, 20207543)
• PP5: Variant 6-129315822-GGTTTCTCTACATATAATCCTCAA-G is Pathogenic according to our data. Variant chr6-129315822-GGTTTCTCTACATATAATCCTCAA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 280520.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000426.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LAMA2	NM_000426.4	MANE Select	c.3799_3821delTTCTCTACATATAATCCTCAAGT	p.Phe1267AspfsTer11	frameshift	Exon 26 of 65	NP_000417.3
	LAMA2	NM_001079823.2		c.3799_3821delTTCTCTACATATAATCCTCAAGT	p.Phe1267AspfsTer11	frameshift	Exon 26 of 64	NP_001073291.2	A0A087WYF1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LAMA2	ENST00000421865.3	TSL:5 MANE Select	c.3799_3821delTTCTCTACATATAATCCTCAAGT	p.Phe1267AspfsTer11	frameshift	Exon 26 of 65	ENSP00000400365.2	P24043
	LAMA2	ENST00000618192.5	TSL:5	c.4063_4085delTTCTCTACATATAATCCTCAAGT	p.Phe1355AspfsTer11	frameshift	Exon 27 of 66	ENSP00000480802.2	A0A087WX80
	LAMA2	ENST00000617695.5	TSL:5	c.3799_3821delTTCTCTACATATAATCCTCAAGT	p.Phe1267AspfsTer11	frameshift	Exon 26 of 64	ENSP00000481744.2	A0A087WYF1

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152198 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000159 AC: 4 AN: 251390 AF XY: 0.0000147

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000352

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000198 AC: 29 AN: 1461790 Hom.: 0 AF XY: 0.0000220 AC XY: 16 AN XY: 727198

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000299 AC: 1 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.0000383 AC: 1 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53346

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000243 AC: 27 AN: 1111990

Other (OTH) AF: 0.00 AC: 0 AN: 60394

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152198 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74352

African (AFR) AF: 0.00 AC: 0 AN: 41448

American (AMR) AF: 0.00 AC: 0 AN: 15276

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5196

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10618

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000294 AC: 2 AN: 68038

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.0000434 Hom.: 0

Bravo AF: 0.0000151

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Merosin deficient congenital muscular dystrophy (2)
2	-	-	not provided (2)
1	-	-	LAMA2-related muscular dystrophy (1)
1	-	-	Merosin deficient congenital muscular dystrophy;C4748327:Muscular dystrophy, limb-girdle, autosomal recessive 23 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs750220830; hg19: chr6-129636967;