rs750290973
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BP6_Very_Strong
The NM_001130987.2(DYSF):c.4387+16_4387+42delATGATGGGCAGGTCAGGGAAGGGGGAG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000627 in 1,608,748 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_001130987.2 intron
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive limb-girdle muscular dystrophyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- neuromuscular disease caused by qualitative or quantitative defects of dysferlinInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- autosomal recessive limb-girdle muscular dystrophy type 2BInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
- distal myopathy with anterior tibial onsetInheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- congenital myopathy, Paradas typeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- Miyoshi myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| DYSF | NM_001130987.2 | c.4387+16_4387+42delATGATGGGCAGGTCAGGGAAGGGGGAG | intron_variant | Intron 39 of 55 | ENST00000410020.8 | NP_001124459.1 | ||
| DYSF | NM_003494.4 | c.4333+16_4333+42delATGATGGGCAGGTCAGGGAAGGGGGAG | intron_variant | Intron 39 of 54 | ENST00000258104.8 | NP_003485.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| DYSF | ENST00000410020.8 | c.4387+10_4387+36delGGGGAGATGATGGGCAGGTCAGGGAAG | intron_variant | Intron 39 of 55 | 1 | NM_001130987.2 | ENSP00000386881.3 | |||
| DYSF | ENST00000258104.8 | c.4333+10_4333+36delGGGGAGATGATGGGCAGGTCAGGGAAG | intron_variant | Intron 39 of 54 | 1 | NM_003494.4 | ENSP00000258104.3 |
Frequencies
GnomAD3 genomes AF: 0.000453 AC: 69AN: 152174Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.000410 AC: 102AN: 248892 AF XY: 0.000454 show subpopulations
GnomAD4 exome AF: 0.000645 AC: 939AN: 1456456Hom.: 0 AF XY: 0.000640 AC XY: 463AN XY: 723366 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000453 AC: 69AN: 152292Hom.: 0 Cov.: 33 AF XY: 0.000390 AC XY: 29AN XY: 74452 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not specified Benign:1
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease.
Neuromuscular disease caused by qualitative or quantitative defects of dysferlin Benign:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at