rs754312472

Variant names:

• chr17-7676105-GGCTGGTGCAGGGGCCGCCGGTGTAGGAGCT-G
• rs754312472
• NM_000546.6:c.234_263delAGCTCCTACACCGGCGGCCCCTGCACCAGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000546.6(TP53):​c.234_263delAGCTCCTACACCGGCGGCCCCTGCACCAGC​(p.Ala79_Ala88del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000274 in 1,460,716 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A78A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000027 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TP53 NM_000546.6 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:9
• Conservation: PhyloP100: 4.75
• Publications: 3 publications found

Genes affected

TP53 (HGNC:11998): (tumor protein p53) This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]

TP53 Gene-Disease associations (from GenCC):

• breast cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
• Li-Fraumeni syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet
• Li-Fraumeni syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
• adrenocortical carcinoma, hereditary

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics
• sarcoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• bone marrow failure syndrome 5

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• colorectal cancer

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• choroid plexus carcinoma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000546.6.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000546.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TP53	NM_000546.6	MANE Select	c.234_263delAGCTCCTACACCGGCGGCCCCTGCACCAGC	p.Ala79_Ala88del	disruptive_inframe_deletion	Exon 4 of 11	NP_000537.3
	TP53	NM_001126112.3		c.234_263delAGCTCCTACACCGGCGGCCCCTGCACCAGC	p.Ala79_Ala88del	disruptive_inframe_deletion	Exon 4 of 11	NP_001119584.1
	TP53	NM_001407262.1		c.234_263delAGCTCCTACACCGGCGGCCCCTGCACCAGC	p.Ala79_Ala88del	disruptive_inframe_deletion	Exon 5 of 12	NP_001394191.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TP53	ENST00000269305.9	TSL:1 MANE Select	c.234_263delAGCTCCTACACCGGCGGCCCCTGCACCAGC	p.Ala79_Ala88del	disruptive_inframe_deletion	Exon 4 of 11	ENSP00000269305.4
	TP53	ENST00000445888.6	TSL:1	c.234_263delAGCTCCTACACCGGCGGCCCCTGCACCAGC	p.Ala79_Ala88del	disruptive_inframe_deletion	Exon 4 of 11	ENSP00000391478.2
	TP53	ENST00000610292.4	TSL:1	c.117_146delAGCTCCTACACCGGCGGCCCCTGCACCAGC	p.Ala40_Ala49del	disruptive_inframe_deletion	Exon 3 of 10	ENSP00000478219.1

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 152144 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000240 AC: 6 AN: 250382 AF XY: 0.0000221

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000326

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000274 AC: 4 AN: 1460716 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726640

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33444

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.0000756 AC: 3 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86206

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53414

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4864

European-Non Finnish (NFE) AF: 8.99e-7 AC: 1 AN: 1111946

Other (OTH) AF: 0.00 AC: 0 AN: 60282

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000000388202), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 152144 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74314

African (AFR) AF: 0.00 AC: 0 AN: 41436

American (AMR) AF: 0.00 AC: 0 AN: 15262

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5190

South Asian (SAS) AF: 0.00 AC: 0 AN: 4826

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68030

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	4	-	Hereditary cancer-predisposing syndrome (4)
-	2	-	Li-Fraumeni syndrome (2)
-	2	-	Li-Fraumeni syndrome 1 (2)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.7
Mutation Taster		=9/191	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs754312472; hg19: chr17-7579423;