rs754312472
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_000546.6(TP53):c.234_263delAGCTCCTACACCGGCGGCCCCTGCACCAGC(p.Ala79_Ala88del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000274 in 1,460,716 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_000546.6 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00 AC: 0AN: 152144Hom.: 0 Cov.: 32 FAILED QC
GnomAD3 exomes AF: 0.0000240 AC: 6AN: 250382Hom.: 0 AF XY: 0.0000221 AC XY: 3AN XY: 135704
GnomAD4 exome AF: 0.00000274 AC: 4AN: 1460716Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 726640
GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0AN: 152144Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74314
ClinVar
Submissions by phenotype
Hereditary cancer-predisposing syndrome Uncertain:4
This variant results in an in-frame deletion of 10 amino acids in the Proline-rich domain of the TP53 protein. This variant is also known as p.78_88del in the literature. To our knowledge, functional studies have not been reported for this variant. This variant has been observed in two individuals affected with breast cancer (PMID: 31119730). This variant also has been identified in 6/250382 chromosomes (6/18390 East Asian chromosomes) in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
- -
- -
The c.234_263del30 variant (also known as p.A79_A88del) is located in coding exon 3 of the TP53 gene. This variant results from an in-frame AGCTCCTACACCGGCGGCCCCTGCACCAGC deletion at nucleotide positions 234 to 263. This results in the in-frame deletion of 10 amino acids (APTPAAPAPA) at positions 79 to 88. In addition, the in silico prediction for this alteration is inconclusive (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -
Li-Fraumeni syndrome Uncertain:2
This variant, c.234_263del, results in the deletion of 10 amino acid(s) of the TP53 protein (p.Ala79_Ala88del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs754312472, gnomAD 0.03%). This variant has been observed in individual(s) with breast cancer (PMID: 31119730). ClinVar contains an entry for this variant (Variation ID: 458529). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. RNA analysis performed to evaluate the impact of this variant on mRNA splicing indicates it does not significantly alter splicing (internal data). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
- -
Li-Fraumeni syndrome 1 Uncertain:2
- -
- -
not provided Uncertain:1
In-frame deletion of 10 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Observed in individuals with breast cancer (PMID: 31119730); This variant is associated with the following publications: (PMID: 31119730, 35820297, 15510160) -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at