rs755752282

Variant names:

• chr6-31863707-A-AGGGCCGGTCCAGGGAGCCGTT
• rs755752282
• NM_025257.3:c.2032_2052dupAACGGCTCCCTGGACCGGCCC

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 2P and 4B. PM4 BS2

The NM_025257.3(SLC44A4):​c.2032_2052dupAACGGCTCCCTGGACCGGCCC​(p.Pro684_Tyr685insAsnGlySerLeuAspArgPro) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000149 in 1,612,418 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000016 (0 hom.)
• Consequence: SLC44A4 NM_025257.3 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -1.66
• Publications: 0 publications found

Genes affected

SLC44A4 (HGNC:13941): (solute carrier family 44 member 4) The protein encoded by this gene may be a sodium-dependent transmembrane transport protein involved in the uptake of choline by cholinergic neurons. Defects in this gene can cause sialidosis, a lysosomal storage disease. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]

SLC44A4 Gene-Disease associations (from GenCC):

• autosomal dominant nonsyndromic hearing loss

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hearing loss, autosomal dominant 72

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• nonsyndromic genetic hearing loss

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_025257.3.
• BS2: High AC in GnomAdExome4 at 23 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_025257.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC44A4	NM_025257.3	MANE Select	c.2032_2052dupAACGGCTCCCTGGACCGGCCC	p.Pro684_Tyr685insAsnGlySerLeuAspArgPro	conservative_inframe_insertion	Exon 21 of 21	NP_079533.2	A0A140VJH4
	SLC44A4	NM_001178044.2		c.1906_1926dupAACGGCTCCCTGGACCGGCCC	p.Pro642_Tyr643insAsnGlySerLeuAspArgPro	conservative_inframe_insertion	Exon 20 of 20	NP_001171515.1	Q53GD3-4
	SLC44A4	NM_001178045.2		c.1804_1824dupAACGGCTCCCTGGACCGGCCC	p.Pro608_Tyr609insAsnGlySerLeuAspArgPro	conservative_inframe_insertion	Exon 21 of 21	NP_001171516.1	A0A1U9X8K7

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC44A4	ENST00000229729.11	TSL:1 MANE Select	c.2032_2052dupAACGGCTCCCTGGACCGGCCC	p.Pro684_Tyr685insAsnGlySerLeuAspArgPro	conservative_inframe_insertion	Exon 21 of 21	ENSP00000229729.6	Q53GD3-1
	SLC44A4	ENST00000882851.1		c.2098_2118dupAACGGCTCCCTGGACCGGCCC	p.Pro706_Tyr707insAsnGlySerLeuAspArgPro	conservative_inframe_insertion	Exon 21 of 21	ENSP00000552910.1
	SLC44A4	ENST00000882853.1		c.2065_2085dupAACGGCTCCCTGGACCGGCCC	p.Pro695_Tyr696insAsnGlySerLeuAspArgPro	conservative_inframe_insertion	Exon 21 of 21	ENSP00000552912.1

Frequencies

GnomAD3 genomes AF: 0.00000658 AC: 1 AN: 151988 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000242

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000818 AC: 2 AN: 244568 AF XY: 0.00000749

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000291

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000917

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000157 AC: 23 AN: 1460430 Hom.: 0 Cov.: 31 AF XY: 0.0000193 AC XY: 14 AN XY: 726524

African (AFR) AF: 0.0000896 AC: 3 AN: 33468

American (AMR) AF: 0.0000224 AC: 1 AN: 44690

Ashkenazi Jewish (ASJ) AF: 0.0000383 AC: 1 AN: 26134

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39668

South Asian (SAS) AF: 0.0000116 AC: 1 AN: 86228

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52304

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000135 AC: 15 AN: 1111788

Other (OTH) AF: 0.0000166 AC: 1 AN: 60382

GnomAD4 genome AF: 0.00000658 AC: 1 AN: 151988 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74228

African (AFR) AF: 0.0000242 AC: 1 AN: 41378

American (AMR) AF: 0.00 AC: 0 AN: 15260

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5182

South Asian (SAS) AF: 0.00 AC: 0 AN: 4812

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10586

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67984

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.0000612 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-1.7
Mutation Taster		=74/26	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs755752282; hg19: chr6-31831484;