rs756614200

Positions:

• chr1-156880037-GCCCGAGAGCATCCTGTACCGTAAGTTC-G

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1 PM2 PM4 PP3

The NM_002529.4(NTRK1):​c.2086_2112delCCCGAGAGCATCCTGTACCGTAAGTTC​(p.Pro696_Phe704del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000315 in 1,461,350 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. P696P) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000031 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: NTRK1 NM_002529.4 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 9.71

Genes affected

NTRK1 (HGNC:8031): (neurotrophic receptor tyrosine kinase 1) This gene encodes a member of the neurotrophic tyrosine kinase receptor (NTKR) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. The presence of this kinase leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in this gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, cognitive disability and cancer. Alternate transcriptional splice variants of this gene have been found, but only three have been characterized to date. [provided by RefSeq, Jul 2008]

NTRK1 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM1: In a hotspot region, there are 4 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 2 benign, 3 uncertain in NM_002529.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_002529.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NTRK1	NM_002529.4	c.2086_2112delCCCGAGAGCATCCTGTACCGTAAGTTC	p.Pro696_Phe704del	conservative_inframe_deletion	16/17	ENST00000524377.7	NP_002520.2
NTRK1	NM_001012331.2	c.2068_2094delCCCGAGAGCATCCTGTACCGTAAGTTC	p.Pro690_Phe698del	conservative_inframe_deletion	15/16		NP_001012331.1
NTRK1	NM_001007792.1	c.1978_2004delCCCGAGAGCATCCTGTACCGTAAGTTC	p.Pro660_Phe668del	conservative_inframe_deletion	16/17		NP_001007793.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NTRK1	ENST00000524377.7	c.2086_2112delCCCGAGAGCATCCTGTACCGTAAGTTC	p.Pro696_Phe704del	conservative_inframe_deletion	16/17	1	NM_002529.4	ENSP00000431418.1

Frequencies

GnomAD3 genomes AF: 0.00 AC: 1 AN: 151978 Hom.: 0 Cov.: 31 FAILED QC

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000315 AC: 46 AN: 1461350 Hom.: 0 AF XY: 0.0000399 AC XY: 29 AN XY: 726982

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000414

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000658 AC: 1 AN: 151978 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 74240

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000147

Gnomad4 OTH AF: 0.00

Bravo AF: 0.00000756

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary insensitivity to pain with anhidrosis Uncertain:2

Uncertain significance, criteria provided, single submitter	clinical testing	Genome-Nilou Lab	Apr 11, 2023	- -
Uncertain significance, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Aug 30, 2021	This variant, c.2068_2094del, results in the deletion of 9 amino acid(s) of the NTRK1 protein (p.Pro690_Phe698del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals affected with NTRK1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Inborn genetic diseases Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

May 19, 2023

The c.2068_2094del27 (p.P690_F698del) alteration is located in exon 15 (coding exon 15) of the NTRK1 gene. This alteration consists of an in-frame deletion of 27 nucleotides between nucleotide positions c.2068 and c.2094, resulting in the deletion of <NA> residues. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs756614200; hg19: chr1-156849829;