rs757307874

Positions:

• chr12-49051373-CAGGTGTGGCTCCTCAGCCTGCGGAGAT-C
• chr12-49051373-C-CAGGTGTGGCTCCTCAGCCTGCGGAGAT

Variant summary

Our verdict is Benign. Variant got -7 ACMG points: 2P and 9B. PM4 BP6 BS1 BS2

The NM_003482.4(KMT2D):​c.2283_2309delATCTCCGCAGGCTGAGGAGCCACACCT​(p.Ser762_Leu770del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00071 in 1,610,820 control chromosomes in the GnomAD database, including 11 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.0035 (4 hom., cov: 29)
  • Exomes 𝑓: 0.00042 (7 hom.)
• Consequence: KMT2D NM_003482.4 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:3
• Conservation: PhyloP100: 1.19

Genes affected

KMT2D (HGNC:7133): (lysine methyltransferase 2D) The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Benign. Variant got -7 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_003482.4.
• BP6: Variant 12-49051373-CAGGTGTGGCTCCTCAGCCTGCGGAGAT-C is Benign according to our data. Variant chr12-49051373-CAGGTGTGGCTCCTCAGCCTGCGGAGAT-C is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 193658.We mark this variant Likely_benign, oryginal submissions are: {Uncertain_significance=1, Benign=3}. Variant chr12-49051373-CAGGTGTGGCTCCTCAGCCTGCGGAGAT-C is described in Lovd as [Likely_benign].
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.0035 (530/151242) while in subpopulation AFR AF= 0.0118 (485/41088). AF 95% confidence interval is 0.0109. There are 4 homozygotes in gnomad4. There are 252 alleles in male gnomad4 subpopulation. Median coverage is 29. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 530 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KMT2D	NM_003482.4	c.2283_2309delATCTCCGCAGGCTGAGGAGCCACACCT	p.Ser762_Leu770del	disruptive_inframe_deletion	11/55	ENST00000301067.12	NP_003473.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KMT2D	ENST00000301067.12	c.2283_2309delATCTCCGCAGGCTGAGGAGCCACACCT	p.Ser762_Leu770del	disruptive_inframe_deletion	11/55	5	NM_003482.4	ENSP00000301067.7
KMT2D	ENST00000683543.2	c.2283_2309delATCTCCGCAGGCTGAGGAGCCACACCT	p.Ser762_Leu770del	disruptive_inframe_deletion	11/56			ENSP00000506726.1
KMT2D	ENST00000685166.1	c.2283_2309delATCTCCGCAGGCTGAGGAGCCACACCT	p.Ser762_Leu770del	disruptive_inframe_deletion	10/54			ENSP00000509386.1
KMT2D	ENST00000692637.1	c.2283_2309delATCTCCGCAGGCTGAGGAGCCACACCT	p.Ser762_Leu770del	disruptive_inframe_deletion	10/54			ENSP00000509666.1

Frequencies

GnomAD3 genomes AF: 0.00349 AC: 527 AN: 151124 Hom.: 4 Cov.: 29

Gnomad AFR AF: 0.0118

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00184

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000419

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00316

Gnomad NFE AF: 0.000103

Gnomad OTH AF: 0.00288

GnomAD3 exomes AF: 0.000967 AC: 234 AN: 241940 Hom.: 2 AF XY: 0.000786 AC XY: 104 AN XY: 132254

Gnomad AFR exome AF: 0.0129

Gnomad AMR exome AF: 0.000786

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000112

Gnomad SAS exome AF: 0.000329

Gnomad FIN exome AF: 0.0000467

Gnomad NFE exome AF: 0.0000649

Gnomad OTH exome AF: 0.000169

GnomAD4 exome AF: 0.000420 AC: 613 AN: 1459578 Hom.: 7 AF XY: 0.000388 AC XY: 282 AN XY: 725956

Gnomad4 AFR exome AF: 0.0112

Gnomad4 AMR exome AF: 0.000851

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000378

Gnomad4 SAS exome AF: 0.000325

Gnomad4 FIN exome AF: 0.0000189

Gnomad4 NFE exome AF: 0.0000837

Gnomad4 OTH exome AF: 0.000912

GnomAD4 genome AF: 0.00350 AC: 530 AN: 151242 Hom.: 4 Cov.: 29 AF XY: 0.00341 AC XY: 252 AN XY: 73950

Gnomad4 AFR AF: 0.0118

Gnomad4 AMR AF: 0.00184

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000419

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000103

Gnomad4 OTH AF: 0.00285

Alfa AF: 0.00115 Hom.: 0

Asia WGS AF: 0.00173 AC: 6 AN: 3478

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:3

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not specified Uncertain:1 Benign:1

Uncertain significance, criteria provided, single submitter	clinical testing	Genetic Services Laboratory, University of Chicago	Oct 10, 2013	- -
Benign, criteria provided, single submitter	clinical testing	Eurofins Ntd Llc (ga)	May 31, 2018	- -

Kabuki syndrome Benign:1

Benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 19, 2024

- -

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

GeneDx

Sep 15, 2020

This variant is associated with the following publications: (PMID: 30107592) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs375538882; hg19: chr12-49445156;