rs758144859

Positions:

• chr17-7220999-GGGGCCTTTGGTCTGCAAGTGCCCAGTGAGCTGGGTGGTGT-G

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2_Supporting PP4

This summary comes from the ClinGen Evidence Repository: The c.428_467del; p.Gly143AlafsTer61 variant in ACADVL results in a frameshift predicted to cause a premature stop codon in biologically relevant exon 6/20 leading to nonsense mediated decay in a gene in which loss-of-function is an established disease mechanism (PVS1: PMIDs 9973285, 11590124). This variant is absent from gnomAD population database v2.1.1 (PM2_Supporting). This variant has also been reported once in a heterozygote patient with Very long chain acyl-coA dehydrogenase deficiency (VLCADD) (PP4, PMID:26385305). The ACADVL Variant Curation Expert Panel VCEP classified the variant as pathogenic based on (PVS1+PM2_supporting, PP4). LINK:https://erepo.genome.network/evrepo/ui/classification/CA8337697/MONDO:0008723/021

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000062 (0 hom.)
• Consequence: ACADVL NM_000018.4 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:6
• Conservation: PhyloP100: 8.78

Genes affected

ACADVL (HGNC:92): (acyl-CoA dehydrogenase very long chain) The protein encoded by this gene is targeted to the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway. This acyl-Coenzyme A dehydrogenase is specific to long-chain and very-long-chain fatty acids. A deficiency in this gene product reduces myocardial fatty acid beta-oxidation and is associated with cardiomyopathy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

ACADVL (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: For more information check the summary or visit ClinGen Evidence Repository.
• PM2: For more information check the summary or visit ClinGen Evidence Repository.
• PP4: For more information check the summary or visit ClinGen Evidence Repository.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ACADVL	NM_000018.4	c.428_467delGTCTGCAAGTGCCCAGTGAGCTGGGTGGTGTGGGCCTTTG	p.Gly143fs	frameshift_variant	6/20	ENST00000356839.10	NP_000009.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ACADVL	ENST00000356839.10	c.428_467delGTCTGCAAGTGCCCAGTGAGCTGGGTGGTGTGGGCCTTTG	p.Gly143fs	frameshift_variant	6/20	1	NM_000018.4	ENSP00000349297.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.00000796 AC: 2 AN: 251380 Hom.: 0 AF XY: 0.00000736 AC XY: 1 AN XY: 135898

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000880

Gnomad OTH exome AF: 0.000163

GnomAD4 exome AF: 0.00000616 AC: 9 AN: 1461800 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 727186

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000629

Gnomad4 OTH exome AF: 0.0000331

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:6

Revision: reviewed by expert panel

Submissions by phenotype

Very long chain acyl-CoA dehydrogenase deficiency Pathogenic:5

Pathogenic, reviewed by expert panel	curation	ClinGen ACADVL Variant Curation Expert Panel, ClinGen	Sep 20, 2022	The c.428_467del; p.Gly143AlafsTer61 variant in ACADVL results in a frameshift predicted to cause a premature stop codon in biologically relevant exon 6/20 leading to nonsense mediated decay in a gene in which loss-of-function is an established disease mechanism (PVS1: PMIDs 9973285, 11590124). This variant is absent from gnomAD population database v2.1.1 (PM2_Supporting). This variant has also been reported once in a heterozygote patient with Very long chain acyl-coA dehydrogenase deficiency (VLCADD) (PP4, PMID:26385305). The ACADVL Variant Curation Expert Panel VCEP classified the variant as pathogenic based on (PVS1+PM2_supporting, PP4). -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Oct 27, 2023	This sequence change creates a premature translational stop signal (p.Gly143Alafs*61) in the ACADVL gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ACADVL are known to be pathogenic (PMID: 9973285, 11590124). This variant is present in population databases (rs758144859, gnomAD 0.0009%). This premature translational stop signal has been observed in individual(s) with a positive newborn screening result for ACADVL-related disease (PMID: 26385305). ClinVar contains an entry for this variant (Variation ID: 422995). For these reasons, this variant has been classified as Pathogenic. -
Pathogenic, criteria provided, single submitter	clinical testing	Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine	Nov 01, 2019	The NM_000018.3:c.428_467del40 (NP_000009.1:p.Gly143AlafsTer61) [GRCH38: NC_000017.11:g.7221009_7221048del] variant in ACADVL gene is interpretated to be Pathogenic based on ACMG guidelines (PMID: 25741868). This variant has been reported. This variant meets the following evidence codes reported in the ACMG guidelines: PVS1, PS3 -
Pathogenic, criteria provided, single submitter	clinical testing	Baylor Genetics	May 23, 2023	- -
Likely pathogenic, no assertion criteria provided	clinical testing	Counsyl	Dec 18, 2017	- -

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Feb 12, 2021

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at a significant frequency in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 26385305) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs758144859; hg19: chr17-7124318;