rs758966808

Variant names:

• chr3-123700336-GGCAGGCTTGGCGTTGCCCATTGGCTTCAGGGTCTCA-G
• rs758966808
• NM_053025.4:c.3096_3131delTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC

Your query was ambiguous. Multiple possible variants found:

• chr3-123700336-GGCAGGCTTGGCGTTGCCCATTGGCTTCAGGGTCTCA-G
• chr3-123700336-GGCAGGCTTGGCGTTGCCCATTGGCTTCAGGGTCTCA-GGCAGGCTTGGCGTTGCCCATTGGCTTCAGGGTCTCAGCAGGCTTGGCGTTGCCCATTGGCTTCAGGGTCTCA

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4 BS1_Supporting

The NM_053025.4(MYLK):​c.3096_3131delTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC​(p.Glu1033_Ala1044del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000238 in 151,568 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.00024 (0 hom., cov: 30)
  • Exomes 𝑓: 0.000055 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MYLK NM_053025.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:5
• Conservation: PhyloP100: 3.04
• Publications: 1 publications found

Genes affected

MYLK (HGNC:7590): (myosin light chain kinase) This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]

MYLK-AS1 (HGNC:42440): (MYLK antisense RNA 1)

LOC105369194 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_053025.4.
• BS1: Variant frequency is greater than expected in population afr. GnomAd4 allele frequency = 0.000238 (36/151568) while in subpopulation AFR AF = 0.000728 (30/41226). AF 95% confidence interval is 0.000524. There are 0 homozygotes in GnomAd4. There are 20 alleles in the male GnomAd4 subpopulation. Median coverage is 30. This position passed quality control check. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_053025.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYLK	NM_053025.4	MANE Select	c.3096_3131delTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC	p.Glu1033_Ala1044del	disruptive_inframe_deletion	Exon 18 of 34	NP_444253.3
	MYLK	NM_053027.4		c.3096_3131delTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC	p.Glu1033_Ala1044del	disruptive_inframe_deletion	Exon 18 of 33	NP_444255.3
	MYLK	NM_053026.4		c.2889_2924delTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC	p.Glu964_Ala975del	disruptive_inframe_deletion	Exon 17 of 33	NP_444254.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYLK	ENST00000360304.8	TSL:5 MANE Select	c.3096_3131delTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC	p.Glu1033_Ala1044del	disruptive_inframe_deletion	Exon 18 of 34	ENSP00000353452.3	Q15746-1
	MYLK	ENST00000504946.6	TSL:1	c.705_740delTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC	p.Glu236_Ala247del	disruptive_inframe_deletion	Exon 2 of 4	ENSP00000510315.1	A0A8I5KYZ0
	MYLK	ENST00000464489.5	TSL:1	n.*2675_*2710delTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC		non_coding_transcript_exon	Exon 17 of 33	ENSP00000417798.1	F8WBL7

Frequencies

GnomAD3 genomes AF: 0.000238 AC: 36 AN: 151568 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.000728

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000194

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000736

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000915 AC: 23 AN: 251462 AF XY: 0.000132

Gnomad AFR exome AF: 0.000431

Gnomad AMR exome AF: 0.0000578

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000163

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000967

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000547 AC: 80 AN: 1461830 Hom.: 0 AF XY: 0.0000578 AC XY: 42 AN XY: 727208

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000568 AC: 19 AN: 33476

American (AMR) AF: 0.0000895 AC: 4 AN: 44714

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26134

East Asian (EAS) AF: 0.000151 AC: 6 AN: 39700

South Asian (SAS) AF: 0.0000348 AC: 3 AN: 86252

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000405 AC: 45 AN: 1111976

Other (OTH) AF: 0.0000497 AC: 3 AN: 60390

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000238 AC: 36 AN: 151568 Hom.: 0 Cov.: 30 AF XY: 0.000270 AC XY: 20 AN XY: 73964

African (AFR) AF: 0.000728 AC: 30 AN: 41226

American (AMR) AF: 0.00 AC: 0 AN: 15226

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3464

East Asian (EAS) AF: 0.000194 AC: 1 AN: 5156

South Asian (SAS) AF: 0.00 AC: 0 AN: 4756

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10542

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000736 AC: 5 AN: 67890

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.000192 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Aortic aneurysm, familial thoracic 7 (1)
-	1	-	Aortic aneurysm, familial thoracic 7;C5542316:Megacystis-microcolon-intestinal hypoperistalsis syndrome 1 (1)
-	1	-	Familial thoracic aortic aneurysm and aortic dissection (1)
-	1	-	MYLK-related disorder (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.0
Mutation Taster		=134/66	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs758966808; hg19: chr3-123419183;