rs759639123

Variant names:

• chr7-131556270-G-GGGCGACGGCGACGGCGACGGC
• rs759639123
• NM_001018111.3:c.69_89dupGCCGTCGCCGTCGCCGTCGCC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001018111.3(PODXL):​c.69_89dupGCCGTCGCCGTCGCCGTCGCC​(p.Pro30_Ser31insProSerProSerProSerPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000022 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PODXL NM_001018111.3 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.516
• Publications: 7 publications found

Genes affected

PODXL (HGNC:9171): (podocalyxin like) This gene encodes a member of the sialomucin protein family. The encoded protein was originally identified as an important component of glomerular podocytes. Podocytes are highly differentiated epithelial cells with interdigitating foot processes covering the outer aspect of the glomerular basement membrane. Other biological activities of the encoded protein include: binding in a membrane protein complex with Na+/H+ exchanger regulatory factor to intracellular cytoskeletal elements, playing a role in hematopoetic cell differentiation, and being expressed in vascular endothelium cells and binding to L-selectin. [provided by RefSeq, Jul 2008]

PODXL Gene-Disease associations (from GenCC):

• atypical juvenile parkinsonism

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• young-onset Parkinson disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000306749 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001018111.3

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001018111.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PODXL	NM_001018111.3	MANE Select	c.69_89dupGCCGTCGCCGTCGCCGTCGCC	p.Pro30_Ser31insProSerProSerProSerPro	disruptive_inframe_insertion	Exon 1 of 9	NP_001018121.1	O00592-1
	PODXL	NM_005397.4		c.69_89dupGCCGTCGCCGTCGCCGTCGCC	p.Pro30_Ser31insProSerProSerProSerPro	disruptive_inframe_insertion	Exon 1 of 8	NP_005388.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PODXL	ENST00000378555.8	TSL:1 MANE Select	c.69_89dupGCCGTCGCCGTCGCCGTCGCC	p.Pro30_Ser31insProSerProSerProSerPro	disruptive_inframe_insertion	Exon 1 of 9	ENSP00000367817.3	O00592-1
	PODXL	ENST00000322985.9	TSL:1	c.69_89dupGCCGTCGCCGTCGCCGTCGCC	p.Pro30_Ser31insProSerProSerProSerPro	disruptive_inframe_insertion	Exon 1 of 8	ENSP00000319782.9	O00592-2
	PODXL	ENST00000923671.1		c.69_89dupGCCGTCGCCGTCGCCGTCGCC	p.Pro30_Ser31insProSerProSerProSerPro	disruptive_inframe_insertion	Exon 1 of 9	ENSP00000593730.1

Frequencies

GnomAD3 genomes AF: 0.00000661 AC: 1 AN: 151220 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000221 AC: 29 AN: 1311416 Hom.: 0 Cov.: 8 AF XY: 0.0000202 AC XY: 13 AN XY: 644804

African (AFR) AF: 0.00 AC: 0 AN: 26806

American (AMR) AF: 0.00 AC: 0 AN: 23898

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 22272

East Asian (EAS) AF: 0.00 AC: 0 AN: 29144

South Asian (SAS) AF: 0.00 AC: 0 AN: 69290

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 40684

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4000

European-Non Finnish (NFE) AF: 0.0000259 AC: 27 AN: 1041424

Other (OTH) AF: 0.0000371 AC: 2 AN: 53898

GnomAD4 genome AF: 0.00000661 AC: 1 AN: 151220 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 73860

African (AFR) AF: 0.00 AC: 0 AN: 40988

American (AMR) AF: 0.00 AC: 0 AN: 15210

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5074

South Asian (SAS) AF: 0.00 AC: 0 AN: 4820

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10540

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 310

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 67822

Other (OTH) AF: 0.00 AC: 0 AN: 2082

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.52
Mutation Taster		=83/17	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs759639123; hg19: chr7-131241029;