rs761662063

Variant names:

• chr1-21850423-TGCCCAACACTCGGCACACGTACTC-T
• rs761662063
• NM_005529.7:c.7210_7233delGAGTACGTGTGCCGAGTGTTGGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001291860.2(HSPG2):​c.7213_7236delGAGTACGTGTGCCGAGTGTTGGGC​(p.Glu2405_Gly2412del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000155 in 1,612,044 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.000092 (0 hom., cov: 33)
  • Exomes 𝑓: 0.00016 (0 hom.)
• Consequence: HSPG2 NM_001291860.2 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 1.46
• Publications: 0 publications found

Genes affected

HSPG2 (HGNC:5273): (heparan sulfate proteoglycan 2) This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]

HSPG2 Gene-Disease associations (from GenCC):

• Schwartz-Jampel syndrome type 1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), G2P
• Silverman-Handmaker type dyssegmental dysplasia

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, ClinGen, Labcorp Genetics (formerly Invitae)
• Schwartz-Jampel syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001291860.2.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001291860.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HSPG2	NM_005529.7	MANE Select	c.7210_7233delGAGTACGTGTGCCGAGTGTTGGGC	p.Glu2404_Gly2411del	conservative_inframe_deletion	Exon 56 of 97	NP_005520.4
	HSPG2	NM_001291860.2		c.7213_7236delGAGTACGTGTGCCGAGTGTTGGGC	p.Glu2405_Gly2412del	conservative_inframe_deletion	Exon 56 of 97	NP_001278789.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HSPG2	ENST00000374695.8	TSL:1 MANE Select	c.7210_7233delGAGTACGTGTGCCGAGTGTTGGGC	p.Glu2404_Gly2411del	conservative_inframe_deletion	Exon 56 of 97	ENSP00000363827.3

Frequencies

GnomAD3 genomes AF: 0.0000920 AC: 14 AN: 152164 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000191

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000733 AC: 18 AN: 245698 AF XY: 0.0000899

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000292

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000154

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000162 AC: 236 AN: 1459880 Hom.: 0 AF XY: 0.000160 AC XY: 116 AN XY: 726142

African (AFR) AF: 0.00 AC: 0 AN: 33446

American (AMR) AF: 0.0000225 AC: 1 AN: 44534

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26104

East Asian (EAS) AF: 0.00 AC: 0 AN: 39662

South Asian (SAS) AF: 0.00 AC: 0 AN: 85978

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52598

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5758

European-Non Finnish (NFE) AF: 0.000208 AC: 231 AN: 1111456

Other (OTH) AF: 0.0000663 AC: 4 AN: 60344

GnomAD4 genome AF: 0.0000920 AC: 14 AN: 152164 Hom.: 0 Cov.: 33 AF XY: 0.0000673 AC XY: 5 AN XY: 74336

African (AFR) AF: 0.0000241 AC: 1 AN: 41450

American (AMR) AF: 0.00 AC: 0 AN: 15284

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5178

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10608

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.000191 AC: 13 AN: 68028

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.0000843 Hom.: 0

Bravo AF: 0.0000756

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	2	-	not provided (2)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.5
Mutation Taster		=39/161	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs761662063; hg19: chr1-22176916; COSMIC: COSV104687843;