rs762617219
Variant summary
Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3BP6_Very_StrongBS1BS2
The NM_001374828.1(ARID1B):c.612_632delACAGCAGCAGCAGCAGCAGCA(p.Gln205_Gln211del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000154 in 1,478,090 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q204dup) has been classified as Uncertain significance.
Frequency
Consequence
NM_001374828.1 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Coffin-Siris syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Illumina, ClinGen, Orphanet
- Coffin-Siris syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -17 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001374828.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARID1B | MANE Select | c.612_632delACAGCAGCAGCAGCAGCAGCA | p.Gln205_Gln211del | disruptive_inframe_deletion | Exon 1 of 20 | NP_001361757.1 | A0A6Q8NVI4 | ||
| ARID1B | c.612_632delACAGCAGCAGCAGCAGCAGCA | p.Gln205_Gln211del | disruptive_inframe_deletion | Exon 1 of 21 | NP_001425411.1 | ||||
| ARID1B | c.612_632delACAGCAGCAGCAGCAGCAGCA | p.Gln205_Gln211del | disruptive_inframe_deletion | Exon 1 of 21 | NP_001425412.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARID1B | TSL:2 MANE Select | c.612_632delACAGCAGCAGCAGCAGCAGCA | p.Gln205_Gln211del | disruptive_inframe_deletion | Exon 1 of 20 | ENSP00000490491.2 | A0A6Q8NVI4 | ||
| ARID1B | TSL:1 | c.612_632delACAGCAGCAGCAGCAGCAGCA | p.Gln205_Gln211del | disruptive_inframe_deletion | Exon 2 of 21 | ENSP00000344546.5 | A0A3F2YNW7 | ||
| ARID1B | TSL:1 | c.612_632delACAGCAGCAGCAGCAGCAGCA | p.Gln205_Gln211del | disruptive_inframe_deletion | Exon 1 of 19 | ENSP00000055163.8 | Q8NFD5-5 |
Frequencies
GnomAD3 genomes AF: 0.000139 AC: 21AN: 150838Hom.: 0 Cov.: 31 show subpopulations
GnomAD2 exomes AF: 0.000150 AC: 19AN: 126552 AF XY: 0.000146 show subpopulations
GnomAD4 exome AF: 0.000155 AC: 206AN: 1327252Hom.: 0 AF XY: 0.000147 AC XY: 96AN XY: 655170 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000139 AC: 21AN: 150838Hom.: 0 Cov.: 31 AF XY: 0.000149 AC XY: 11AN XY: 73632 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at