rs762863407

Variant names:

• chr22-28734614-C-CTGGGACTGTGAGGAGGAGCCT
• rs762863407
• NM_007194.4:c.87_107dupAGGCTCCTCCTCACAGTCCCA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_007194.4(CHEK2):​c.87_107dupAGGCTCCTCCTCACAGTCCCA​(p.Gln36_Gly37insGlySerSerSerGlnSerGln) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,876 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. Q36Q) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: CHEK2 NM_007194.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 1.64
• Publications: 0 publications found

Genes affected

CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

CHEK2 Gene-Disease associations (from GenCC):

• CHEK2-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics, ClinGen
• Li-Fraumeni syndrome 2

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• hereditary breast carcinoma

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• acute myeloid leukemia

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary nonpolyposis colon cancer

  Inheritance: Unknown Classification: LIMITED Submitted by: ClinGen
• familial ovarian cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_007194.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007194.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHEK2	NM_007194.4	MANE Select	c.87_107dupAGGCTCCTCCTCACAGTCCCA	p.Gln36_Gly37insGlySerSerSerGlnSerGln	disruptive_inframe_insertion	Exon 2 of 15	NP_009125.1	O96017-1
	CHEK2	NM_001005735.3		c.87_107dupAGGCTCCTCCTCACAGTCCCA	p.Gln36_Gly37insGlySerSerSerGlnSerGln	disruptive_inframe_insertion	Exon 2 of 16	NP_001005735.1
	CHEK2	NM_001438293.1		c.87_107dupAGGCTCCTCCTCACAGTCCCA	p.Gln36_Gly37insGlySerSerSerGlnSerGln	disruptive_inframe_insertion	Exon 2 of 16	NP_001425222.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHEK2	ENST00000404276.6	TSL:1 MANE Select	c.87_107dupAGGCTCCTCCTCACAGTCCCA	p.Gln36_Gly37insGlySerSerSerGlnSerGln	disruptive_inframe_insertion	Exon 2 of 15	ENSP00000385747.1	O96017-1
	CHEK2	ENST00000382580.6	TSL:1	c.87_107dupAGGCTCCTCCTCACAGTCCCA	p.Gln36_Gly37insGlySerSerSerGlnSerGln	disruptive_inframe_insertion	Exon 2 of 16	ENSP00000372023.2	O96017-9
	CHEK2	ENST00000402731.6	TSL:1	c.87_107dupAGGCTCCTCCTCACAGTCCCA	p.Gln36_Gly37insGlySerSerSerGlnSerGln	disruptive_inframe_insertion	Exon 1 of 13	ENSP00000384835.2	A0A7P0MUT5

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD2 exomes AF: 0.00000798 AC: 2 AN: 250608 AF XY: 0.00000738

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000578

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1461876 Hom.: 0 Cov.: 33 AF XY: 0.00000138 AC XY: 1 AN XY: 727236

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.0000447 AC: 2 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53406

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1112010

Other (OTH) AF: 0.00 AC: 0 AN: 60394

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	2	-	Familial cancer of breast (2)
-	1	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs762863407; hg19: chr22-29130602;