rs762863407
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_007194.4(CHEK2):c.87_107dupAGGCTCCTCCTCACAGTCCCA(p.Gln36_Gly37insGlySerSerSerGlnSerGln) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,876 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_007194.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD3 exomes AF: 0.00000798 AC: 2AN: 250608Hom.: 0 AF XY: 0.00000738 AC XY: 1AN XY: 135430
GnomAD4 exome AF: 0.00000137 AC: 2AN: 1461876Hom.: 0 Cov.: 33 AF XY: 0.00000138 AC XY: 1AN XY: 727236
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Familial cancer of breast Uncertain:2
- -
This variant, c.87_107dup, results in the insertion of 7 amino acid(s) of the CHEK2 protein (p.Ser31_Gly37dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs762863407, gnomAD 0.006%). This variant has not been reported in the literature in individuals affected with CHEK2-related conditions. ClinVar contains an entry for this variant (Variation ID: 483400). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Hereditary cancer-predisposing syndrome Uncertain:1
The c.87_107dup21 variant (also known as p.S31_G37dup), located in coding exon 1 of the CHEK2 gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 87 to 107. This results in the duplication of 7 extra residues (SSSQSQG) between codons 31 and 37. This duplication is located in the SQ/TQ cluster domain of the CHEK2 gene (Matsuoka S, et al. Proc. Natl. Acad. Sci. U.S.A. 2000 Sep; 97(19):10389-94). This amino acid region is not well conserved in available vertebrate species. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at