rs762863407

Variant names:

• chr22-28734614-C-CTGGGACTGTGAGGAGGAGCCT
• rs762863407
• NM_007194.4:c.87_107dupAGGCTCCTCCTCACAGTCCCA

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_007194.4(CHEK2):​c.87_107dupAGGCTCCTCCTCACAGTCCCA​(p.Gln36_Gly37insGlySerSerSerGlnSerGln) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,876 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: CHEK2 NM_007194.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 1.64

Genes affected

CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_007194.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CHEK2	NM_007194.4	c.87_107dupAGGCTCCTCCTCACAGTCCCA	p.Gln36_Gly37insGlySerSerSerGlnSerGln	disruptive_inframe_insertion	Exon 2 of 15	ENST00000404276.6	NP_009125.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CHEK2	ENST00000404276.6	c.87_107dupAGGCTCCTCCTCACAGTCCCA	p.Gln36_Gly37insGlySerSerSerGlnSerGln	disruptive_inframe_insertion	Exon 2 of 15	1	NM_007194.4	ENSP00000385747.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD3 exomes AF: 0.00000798 AC: 2 AN: 250608 Hom.: 0 AF XY: 0.00000738 AC XY: 1 AN XY: 135430

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000578

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1461876 Hom.: 0 Cov.: 33 AF XY: 0.00000138 AC XY: 1 AN XY: 727236

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000447

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial cancer of breast Uncertain:2

Mar 24, 2024

Baylor Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Nov 10, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.87_107dup, results in the insertion of 7 amino acid(s) of the CHEK2 protein (p.Ser31_Gly37dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs762863407, gnomAD 0.006%). This variant has not been reported in the literature in individuals affected with CHEK2-related conditions. ClinVar contains an entry for this variant (Variation ID: 483400). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Hereditary cancer-predisposing syndrome Uncertain:1

Nov 08, 2024

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.87_107dup21 variant (also known as p.S31_G37dup), located in coding exon 1 of the CHEK2 gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 87 to 107. This results in the duplication of 7 extra residues (SSSQSQG) between codons 31 and 37. This duplication is located in the SQ/TQ cluster domain of the CHEK2 gene (Matsuoka S, et al. Proc. Natl. Acad. Sci. U.S.A. 2000 Sep; 97(19):10389-94). This amino acid region is not well conserved in available vertebrate species. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs762863407; hg19: chr22-29130602;