rs762863407
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_007194.4(CHEK2):c.87_107dupAGGCTCCTCCTCACAGTCCCA(p.Gln36_Gly37insGlySerSerSerGlnSerGln) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,876 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. Q36Q) has been classified as Likely benign.
Frequency
Consequence
NM_007194.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- CHEK2-related cancer predispositionInheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
- Li-Fraumeni syndrome 2Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
- acute myeloid leukemiaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- hereditary nonpolyposis colon cancerInheritance: AD Classification: LIMITED Submitted by: ClinGen
- familial ovarian cancerInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD2 exomes AF: 0.00000798 AC: 2AN: 250608 AF XY: 0.00000738 show subpopulations
GnomAD4 exome AF: 0.00000137 AC: 2AN: 1461876Hom.: 0 Cov.: 33 AF XY: 0.00000138 AC XY: 1AN XY: 727236 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Familial cancer of breast Uncertain:2
- -
This variant, c.87_107dup, results in the insertion of 7 amino acid(s) of the CHEK2 protein (p.Ser31_Gly37dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs762863407, gnomAD 0.006%). This variant has not been reported in the literature in individuals affected with CHEK2-related conditions. ClinVar contains an entry for this variant (Variation ID: 483400). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Hereditary cancer-predisposing syndrome Uncertain:1
The c.87_107dup21 variant (also known as p.S31_G37dup), located in coding exon 1 of the CHEK2 gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 87 to 107. This results in the duplication of 7 extra residues (SSSQSQG) between codons 31 and 37. This duplication is located in the SQ/TQ cluster domain of the CHEK2 gene (Matsuoka S, et al. Proc. Natl. Acad. Sci. U.S.A. 2000 Sep; 97(19):10389-94). This amino acid region is not well conserved in available vertebrate species. In addition, this alteration is predicted to be neutral by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at