rs764208864

Variant names:

• chr19-40396750-T-TGGCACCTTTGGGAGTTTCATCTCC
• rs764208864
• NM_181882.3:c.1578_1601dupGGAGATGAAACTCCCAAAGGTGCC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_181882.3(PRX):​c.1578_1601dupGGAGATGAAACTCCCAAAGGTGCC​(p.Pro534_Glu535insGluMetLysLeuProLysValPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000198 in 151,516 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000082 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PRX NM_181882.3 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 1.46
• Publications: 0 publications found

Genes affected

PRX (HGNC:13797): (periaxin) This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]

PRX Gene-Disease associations (from GenCC):

• Charcot-Marie-Tooth disease type 4

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Charcot-Marie-Tooth disease type 4F

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
• Charcot-Marie-Tooth disease type 3

  Inheritance: AR, AD Classification: MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_181882.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_181882.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PRX	NM_181882.3	MANE Select	c.1578_1601dupGGAGATGAAACTCCCAAAGGTGCC	p.Pro534_Glu535insGluMetLysLeuProLysValPro	disruptive_inframe_insertion	Exon 7 of 7	NP_870998.2	Q9BXM0-1
	PRX	NM_001411127.1		c.1863_1886dupGGAGATGAAACTCCCAAAGGTGCC	p.Pro629_Glu630insGluMetLysLeuProLysValPro	disruptive_inframe_insertion	Exon 7 of 7	NP_001398056.1	A0A669KBF1
	PRX	NM_020956.2		c.*1783_*1806dupGGAGATGAAACTCCCAAAGGTGCC		3_prime_UTR	Exon 6 of 6	NP_066007.1	Q9BXM0-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PRX	ENST00000324001.8	TSL:1 MANE Select	c.1578_1601dupGGAGATGAAACTCCCAAAGGTGCC	p.Pro534_Glu535insGluMetLysLeuProLysValPro	disruptive_inframe_insertion	Exon 7 of 7	ENSP00000326018.6	Q9BXM0-1
	PRX	ENST00000291825.11	TSL:1	c.*1783_*1806dupGGAGATGAAACTCCCAAAGGTGCC		3_prime_UTR	Exon 6 of 6	ENSP00000291825.6	Q9BXM0-2
	PRX	ENST00000674005.2		c.1863_1886dupGGAGATGAAACTCCCAAAGGTGCC	p.Pro629_Glu630insGluMetLysLeuProLysValPro	disruptive_inframe_insertion	Exon 7 of 7	ENSP00000501261.1	A0A669KBF1

Frequencies

GnomAD3 genomes AF: 0.0000198 AC: 3 AN: 151516 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000442

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000399 AC: 1 AN: 250646 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000883

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000823 AC: 12 AN: 1458364 Hom.: 0 Cov.: 37 AF XY: 0.00000827 AC XY: 6 AN XY: 725298

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33422

American (AMR) AF: 0.00 AC: 0 AN: 44020

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26112

East Asian (EAS) AF: 0.00 AC: 0 AN: 39252

South Asian (SAS) AF: 0.00 AC: 0 AN: 85588

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53328

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5760

European-Non Finnish (NFE) AF: 0.0000108 AC: 12 AN: 1110628

Other (OTH) AF: 0.00 AC: 0 AN: 60254

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000229539), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000198 AC: 3 AN: 151516 Hom.: 0 Cov.: 33 AF XY: 0.0000270 AC XY: 2 AN XY: 74002

African (AFR) AF: 0.00 AC: 0 AN: 41192

American (AMR) AF: 0.00 AC: 0 AN: 15228

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5116

South Asian (SAS) AF: 0.00 AC: 0 AN: 4788

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10548

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.0000442 AC: 3 AN: 67866

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Charcot-Marie-Tooth disease type 4 (1)
-	1	-	Inborn genetic diseases (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.5
Mutation Taster		=72/28	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs764208864;

hg19: chr19-40902657;