rs76675173

Variant names:

• chr10-100749831-GCTGGCCCACCAGGGTGTGCGGC-G
• rs76675173
• NM_000278.5:c.131_152delTGGCCCACCAGGGTGTGCGGCC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_000278.5(PAX2):​c.131_152delTGGCCCACCAGGGTGTGCGGCC​(p.Leu44ProfsTer32) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: PAX2 NM_000278.5 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 10.0
• Publications: 1 publications found

Genes affected

PAX2 (HGNC:8616): (paired box 2) PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]

PAX2 Gene-Disease associations (from GenCC):

• focal segmental glomerulosclerosis 7

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• renal coloboma syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P
• familial idiopathic steroid-resistant nephrotic syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 10-100749831-GCTGGCCCACCAGGGTGTGCGGC-G is Pathogenic according to our data. Variant chr10-100749831-GCTGGCCCACCAGGGTGTGCGGC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 13797.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PAX2	NM_000278.5	c.131_152delTGGCCCACCAGGGTGTGCGGCC	p.Leu44ProfsTer32	frameshift_variant	Exon 2 of 10	ENST00000355243.8	NP_000269.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PAX2	ENST00000355243.8	c.131_152delTGGCCCACCAGGGTGTGCGGCC	p.Leu44ProfsTer32	frameshift_variant	Exon 2 of 10	1	NM_000278.5	ENSP00000347385.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Renal coloboma syndrome Pathogenic:1

Mar 01, 2012

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs76675173; hg19: chr10-102509588;