rs767703623

Positions:

• chr9-128190808-AGCTGCTGCTGCTGTTGCTGGAGCT-A

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001131016.2(CIZ1):​c.26_49delAGCTCCAGCAACAGCAGCAGCAGC​(p.Gln9_Gln16del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00113 in 1,541,198 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.0011 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0011 (0 hom.)
• Consequence: CIZ1 NM_001131016.2 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 0.137

Genes affected

CIZ1 (HGNC:16744): (CDKN1A interacting zinc finger protein 1) The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001131016.2
• BS2: High AC in GnomAd4 at 160 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CIZ1	NM_001131016.2	c.26_49delAGCTCCAGCAACAGCAGCAGCAGC	p.Gln9_Gln16del	disruptive_inframe_deletion	2/17	ENST00000372938.10	NP_001124488.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CIZ1	ENST00000372938.10	c.26_49delAGCTCCAGCAACAGCAGCAGCAGC	p.Gln9_Gln16del	disruptive_inframe_deletion	2/17	1	NM_001131016.2	ENSP00000362029.5

Frequencies

GnomAD3 genomes AF: 0.00105 AC: 160 AN: 151858 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.000314

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000721

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00576

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00107

Gnomad OTH AF: 0.000959

GnomAD3 exomes AF: 0.000501 AC: 74 AN: 147838 Hom.: 0 AF XY: 0.000421 AC XY: 33 AN XY: 78380

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000367

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.0000443

Gnomad FIN exome AF: 0.00208

Gnomad NFE exome AF: 0.000648

Gnomad OTH exome AF: 0.000922

GnomAD4 exome AF: 0.00113 AC: 1576 AN: 1389222 Hom.: 0 AF XY: 0.00109 AC XY: 749 AN XY: 685614

Gnomad4 AFR exome AF: 0.000127

Gnomad4 AMR exome AF: 0.000337

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000837

Gnomad4 SAS exome AF: 0.0000379

Gnomad4 FIN exome AF: 0.00342

Gnomad4 NFE exome AF: 0.00125

Gnomad4 OTH exome AF: 0.00104

GnomAD4 genome AF: 0.00105 AC: 160 AN: 151976 Hom.: 0 Cov.: 31 AF XY: 0.00133 AC XY: 99 AN XY: 74264

Gnomad4 AFR AF: 0.000314

Gnomad4 AMR AF: 0.000720

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00576

Gnomad4 NFE AF: 0.00107

Gnomad4 OTH AF: 0.000949

Alfa AF: 0.000378 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:2

Uncertain significance, criteria provided, single submitter	clinical testing	Revvity Omics, Revvity	Feb 08, 2022	- -
Uncertain significance, criteria provided, single submitter	not provided	Breakthrough Genomics, Breakthrough Genomics	-	- -

Dystonic disorder Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jul 23, 2023

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. ClinVar contains an entry for this variant (Variation ID: 455982). This variant has not been reported in the literature in individuals affected with CIZ1-related conditions. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant, c.26_49del, results in the deletion of 8 amino acid(s) of the CIZ1 protein (p.Gln9_Gln16del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs767703623; hg19: chr9-130953087;