rs767703623

Variant names:

• chr9-128190808-AGCTGCTGCTGCTGTTGCTGGAGCT-A
• rs767703623
• NM_001131016.2:c.26_49delAGCTCCAGCAACAGCAGCAGCAGC

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001131016.2(CIZ1):​c.26_49delAGCTCCAGCAACAGCAGCAGCAGC​(p.Gln9_Gln16del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00113 in 1,541,198 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. Q9Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0011 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0011 (0 hom.)
• Consequence: CIZ1 NM_001131016.2 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 0.137
• Publications: 0 publications found

Genes affected

CIZ1 (HGNC:16744): (CDKN1A interacting zinc finger protein 1) The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

CIZ1 Gene-Disease associations (from GenCC):

• dystonia 23

  Inheritance: Unknown Classification: MODERATE Submitted by: Genomics England PanelApp
• inherited dystonia

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001131016.2
• BS2: High AC in GnomAd4 at 160 AD,Unknown gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CIZ1	NM_001131016.2	c.26_49delAGCTCCAGCAACAGCAGCAGCAGC	p.Gln9_Gln16del	disruptive_inframe_deletion	Exon 2 of 17	ENST00000372938.10	NP_001124488.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CIZ1	ENST00000372938.10	c.26_49delAGCTCCAGCAACAGCAGCAGCAGC	p.Gln9_Gln16del	disruptive_inframe_deletion	Exon 2 of 17	1	NM_001131016.2	ENSP00000362029.5

Frequencies

GnomAD3 genomes AF: 0.00105 AC: 160 AN: 151858 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.000314

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000721

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00576

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00107

Gnomad OTH AF: 0.000959

GnomAD2 exomes AF: 0.000501 AC: 74 AN: 147838 AF XY: 0.000421

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000367

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00208

Gnomad NFE exome AF: 0.000648

Gnomad OTH exome AF: 0.000922

GnomAD4 exome AF: 0.00113 AC: 1576 AN: 1389222 Hom.: 0 AF XY: 0.00109 AC XY: 749 AN XY: 685614

African (AFR) AF: 0.000127 AC: 4 AN: 31580

American (AMR) AF: 0.000337 AC: 12 AN: 35594

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24962

East Asian (EAS) AF: 0.0000837 AC: 3 AN: 35830

South Asian (SAS) AF: 0.0000379 AC: 3 AN: 79134

European-Finnish (FIN) AF: 0.00342 AC: 148 AN: 43244

Middle Eastern (MID) AF: 0.000640 AC: 3 AN: 4684

European-Non Finnish (NFE) AF: 0.00125 AC: 1343 AN: 1076472

Other (OTH) AF: 0.00104 AC: 60 AN: 57722

GnomAD4 genome AF: 0.00105 AC: 160 AN: 151976 Hom.: 0 Cov.: 31 AF XY: 0.00133 AC XY: 99 AN XY: 74264

African (AFR) AF: 0.000314 AC: 13 AN: 41462

American (AMR) AF: 0.000720 AC: 11 AN: 15272

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.00 AC: 0 AN: 5160

South Asian (SAS) AF: 0.00 AC: 0 AN: 4808

European-Finnish (FIN) AF: 0.00576 AC: 61 AN: 10586

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00107 AC: 73 AN: 67918

Other (OTH) AF: 0.000949 AC: 2 AN: 2108

Alfa AF: 0.000378 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:2

Feb 08, 2022

Revvity Omics, Revvity

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

-

Breakthrough Genomics, Breakthrough Genomics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: not provided

- -

Dystonic disorder Uncertain:1

Sep 06, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.26_49del, results in the deletion of 8 amino acid(s) of the CIZ1 protein (p.Gln9_Gln16del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with CIZ1-related conditions. ClinVar contains an entry for this variant (Variation ID: 455982). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.14
Mutation Taster		=152/48	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs767703623; hg19: chr9-130953087;