rs769664228
Variant summary
Our verdict is Pathogenic. The variant received 15 ACMG points: 15P and 0B. PS3PM4PP3PP5_Very_Strong
The NM_000342.4(SLC4A1):c.1199_1225delCATTCAGCCCCCAGGTCCTGGCTGCCG(p.Ala400_Ala408del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000173 in 1,613,878 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV001574307: Experimental studies have shown that this variant affects SLC4A1 function (PMID:7689982, 16107207).".
Frequency
Consequence
NM_000342.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- autosomal dominant distal renal tubular acidosisInheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P
- cryohydrocytosisInheritance: AD, Unknown Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), PanelApp Australia
- hereditary spherocytosis type 4Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- southeast Asian ovalocytosisInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
- renal tubular acidosis, distal, 4, with hemolytic anemiaInheritance: AR, AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Orphanet
- dehydrated hereditary stomatocytosisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary spherocytosisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 15 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000342.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SLC4A1 | TSL:1 MANE Select | c.1199_1225delCATTCAGCCCCCAGGTCCTGGCTGCCG | p.Ala400_Ala408del | disruptive_inframe_deletion | Exon 11 of 20 | ENSP00000262418.6 | P02730-1 | ||
| SLC4A1 | TSL:5 | c.777+1193_777+1219delCATTCAGCCCCCAGGTCCTGGCTGCCG | intron | N/A | ENSP00000382190.3 | A0A0A0MS98 |
Frequencies
GnomAD3 genomes AF: 0.0000395 AC: 6AN: 152006Hom.: 0 Cov.: 31 show subpopulations
GnomAD2 exomes AF: 0.0000477 AC: 12AN: 251416 AF XY: 0.0000294 show subpopulations
GnomAD4 exome AF: 0.0000150 AC: 22AN: 1461872Hom.: 0 AF XY: 0.0000124 AC XY: 9AN XY: 727240 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000395 AC: 6AN: 152006Hom.: 0 Cov.: 31 AF XY: 0.0000135 AC XY: 1AN XY: 74238 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at