rs769664228

Variant names:

• chr17-44258042-ACGGCAGCCAGGACCTGGGGGCTGAATG-A
• rs769664228
• NM_000342.4:c.1199_1225delCATTCAGCCCCCAGGTCCTGGCTGCCG

Variant summary

Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PM4 PP3 PP5_Very_Strong

The NM_000342.4(SLC4A1):​c.1199_1225delCATTCAGCCCCCAGGTCCTGGCTGCCG​(p.Ala400_Ala408del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000173 in 1,613,878 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000039 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000015 (0 hom.)
• Consequence: SLC4A1 NM_000342.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:10 B:1
• Conservation: PhyloP100: 9.96
• Publications: 4 publications found

Genes affected

SLC4A1 (HGNC:11027): (solute carrier family 4 member 1 (Diego blood group)) The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]

SLC4A1 Gene-Disease associations (from GenCC):

• autosomal dominant distal renal tubular acidosis

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae)
• hereditary spherocytosis type 4

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• renal tubular acidosis, distal, 4, with hemolytic anemia

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• southeast Asian ovalocytosis

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
• dehydrated hereditary stomatocytosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary spherocytosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• cryohydrocytosis

  Inheritance: Unknown, AD Classification: SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 11 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000342.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 17-44258042-ACGGCAGCCAGGACCTGGGGGCTGAATG-A is Pathogenic according to our data. Variant chr17-44258042-ACGGCAGCCAGGACCTGGGGGCTGAATG-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 17753.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SLC4A1	NM_000342.4	c.1199_1225delCATTCAGCCCCCAGGTCCTGGCTGCCG	p.Ala400_Ala408del	disruptive_inframe_deletion	Exon 11 of 20	ENST00000262418.12	NP_000333.1
SLC4A1	XM_011525129.3	c.1199_1225delCATTCAGCCCCCAGGTCCTGGCTGCCG	p.Ala400_Ala408del	disruptive_inframe_deletion	Exon 11 of 19		XP_011523431.1
SLC4A1	XM_005257593.6	c.1004_1030delCATTCAGCCCCCAGGTCCTGGCTGCCG	p.Ala335_Ala343del	disruptive_inframe_deletion	Exon 9 of 18		XP_005257650.1
SLC4A1	XM_011525130.2	c.1199_1225delCATTCAGCCCCCAGGTCCTGGCTGCCG	p.Ala400_Ala408del	disruptive_inframe_deletion	Exon 11 of 18		XP_011523432.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SLC4A1	ENST00000262418.12	c.1199_1225delCATTCAGCCCCCAGGTCCTGGCTGCCG	p.Ala400_Ala408del	disruptive_inframe_deletion	Exon 11 of 20	1	NM_000342.4	ENSP00000262418.6
SLC4A1	ENST00000399246.3	c.777+1193_777+1219delCATTCAGCCCCCAGGTCCTGGCTGCCG		intron_variant	Intron 9 of 14	5		ENSP00000382190.3

Frequencies

GnomAD3 genomes AF: 0.0000395 AC: 6 AN: 152006 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000967

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000193

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000477 AC: 12 AN: 251416 AF XY: 0.0000294

Gnomad AFR exome AF: 0.000308

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000163

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.000489

GnomAD4 exome AF: 0.0000150 AC: 22 AN: 1461872 Hom.: 0 AF XY: 0.0000124 AC XY: 9 AN XY: 727240

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000299 AC: 1 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.0000756 AC: 3 AN: 39700

South Asian (SAS) AF: 0.0000116 AC: 1 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53402

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1112008

Other (OTH) AF: 0.000248 AC: 15 AN: 60396

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000395 AC: 6 AN: 152006 Hom.: 0 Cov.: 31 AF XY: 0.0000135 AC XY: 1 AN XY: 74238

African (AFR) AF: 0.0000967 AC: 4 AN: 41358

American (AMR) AF: 0.00 AC: 0 AN: 15264

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.000193 AC: 1 AN: 5184

South Asian (SAS) AF: 0.00 AC: 0 AN: 4814

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10594

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68008

Other (OTH) AF: 0.00 AC: 0 AN: 2088

Alfa AF: 0.000130 Hom.: 0

Bravo AF: 0.0000416

Asia WGS AF: 0.00606 AC: 21 AN: 3478

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:10 Benign:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:4

Dec 21, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.1199_1225del, results in the deletion of 9 amino acid(s) of the SLC4A1 protein (p.Ala400_Ala408del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs769664228, gnomAD 0.02%). This variant has been observed in individual(s) with autosomal dominant ovalocytosis and/or autosomal recessive distal renal tubular acidosis (PMID: 1722314, 1737855, 7919393, 7949112, 14618420, 19229254, 24652967, 28188436, 31672324, 31959358; Invitae). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 17753). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects SLC4A1 function (PMID: 7689982, 16107207). For these reasons, this variant has been classified as Pathogenic. -

May 24, 2024

Mayo Clinic Laboratories, Mayo Clinic

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Sep 25, 2023

Revvity Omics, Revvity

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Oct 04, 2024

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The SLC4A1 c.1199_1225del; p.Ala400_Ala408del variant (rs769664228) is a well-documented defect in individuals with Southeast Asian ovalocytosis (SAO) characterized by increased stomatocytes in the peripheral blood smear (Jarolim 1991, King 2009, Prayongratana 2019). While this variant leads to erythrocyte membrane deformation, the resulting ovalocytic erythrocytes are reported to be resistant to malarial parasitic invasion (Jarolim 1991). However, compound heterozygotes with a second SLC4A1 variant demonstrated hemolytic anemia, abnormal red cell membrane properties, along with distal renal tubular acidosis (Bruce 2000, Sritippayawan 2004). This variant is reported as both pathogenic and protective in ClinVar (Variation ID: 17753). This variant is found in the general population with an overall allele frequency of 0.005% (13/282788 alleles) in the Genome Aggregation Database. This variant deletes 9 amino acid residues in erythrocyte band 3 protein, also known as anion exchanger 1 (AE1), leaving the rest of the protein in-frame. Based on available information, this variant is considered to be pathogenic. References: Jarolim P et al. Deletion in erythrocyte band 3 gene in malaria-resistant Southeast Asian ovalocytosis. Proc Natl Acad Sci U S A. 1991 88:11022-11026. PMID: 1722314 King MJ et al. The mutant erythrocyte band 3 protein in Southeast Asian ovalocytosis does not bind eosin-5-maleimide. Int J Lab Hematol. 2009 31:116-117. PMID: 19230205 Prayongratana K et al. Co-inheritance of Southeast Asian Ovalocytosis (SAO) and G6PD deficiency associated with acute hemolysis in a Thai patient. Blood Cells Mol Dis. 2019 79:102347. PMID: 31323480 -

Southeast Asian ovalocytosis Pathogenic:3

Mar 01, 2009

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Mar 21, 2024

3billion

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The variant is observed at an allele frequency greater than expected for the associated disorder in the gnomAD v4.0.0 dataset and therefore considered benign. Predicted Consequence/Location: Inframe deletion located in a nonrepeat region: predicted to change the length of the protein and disrupt normal protein function. The variant has been reported to co-segregate with the disease in at least 5 similarly affected relatives/individuals in the same family or similarly affected unrelated families (PMID: 1722314). The variant has been reported at least twice as pathogenic with clinical assertions and evidence for the classification (ClinVar ID: VCV000017753 /PMID: 1722314 /3billion dataset). Therefore, this variant is classified as Likely pathogenic according to the recommendation of ACMG/AMP guideline. -

May 06, 2021

Victorian Clinical Genetics Services, Murdoch Childrens Research Institute

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0103 - Dominant negative and loss of function are known mechanisms of disease in this gene and are associated with SLC4A1-related disease. Spherocytosis type 4 (MIM#612653) is caused by variants with a loss of function mechanism. Cryohydrocytosis (MIM#185020), distal renal tubular acidosis (dRTA) (MIM#1179800), dRTA 4 with hemolytic anemia (MIM#611590) and SA type ovalocytosis (SAO) (MIM#166900) are caused by variants with either a loss of function, or dominant negative mechanism (PMID: 27058983). (I) 0108 - This gene is associated with both recessive and dominant disease. Most reports for this gene are for dominant disease, however, individuals biallelic for variants causing SAO have the more severe phenotype, dRTA with hemolytic anemia (OMIM, PMID: 17557941). (I) 0213 - In-frame insertion/deletion in a non-repetitive region that has moderate conservation. (SP) 0252 - This variant is homozygous. (I) 0304 - Variant is present in gnomAD (v2) <0.01 for a recessive condition (13 heterozygotes, 0 homozygotes). (SP) 0600 - Variant is located in the annotated anion exchange transporter domain (UniProt, DECIPHER). (I) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. This variant has been observed in many heterozygous individuals with SA type ovalocytosis, and is highly prevalent within South Asian populations (PMID: 30124986, PMID: 19229254, PMID: 7949112). Additionally, carriers of this variant have some resistance to all forms of malaria (PMID: 31364155, OMIM). It is highly likely to be lethal in homozygosity, where rare survivors demonstrate severe anaemia, hydrops and distal renal tubular acidosis (PMID: 24652967). (SP) 1102 - Strong phenotype match for this individual. (SP) 1209 - This variant has been shown to be both maternally and paternally inherited (biallelic) (by trio analysis). (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign -

Renal tubular acidosis, distal, 4, with hemolytic anemia Pathogenic:1

May 19, 2023

Institute of Human Genetics, University of Leipzig Medical Center

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Criteria applied: PM5_STR,PM4,PM2_SUP -

BLOOD GROUP--DIEGO SYSTEM;C1832168:BLOOD GROUP--FROESE;C1832169:BLOOD GROUP--SWANN SYSTEM;C1861453:Cryohydrocytosis;C1862190:BLOOD GROUP--WRIGHT ANTIGEN;C1862191:BLOOD GROUP--WALDNER TYPE;C1862322:Southeast Asian ovalocytosis;C1970028:Malaria, susceptibility to;C2675212:Hereditary spherocytosis type 4;C5436235:Renal tubular acidosis, distal, 4, with hemolytic anemia;CN280572:Autosomal dominant distal renal tubular acidosis Pathogenic:1

Mar 21, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Distal renal tubular acidosis Pathogenic:1

Oct 22, 2019

Yale Center for Mendelian Genomics, Yale University

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Malaria, cerebral, resistance to Benign:1

Mar 01, 2009

OMIM

Significance: protective

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=3/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs769664228; hg19: chr17-42335410;