rs770991996

Variant names:

• chr17-4933876-GGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCCA-G
• rs770991996
• NM_000173.7:c.1311_1349delAGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCC

Variant summary

Our verdict is Benign. The variant received -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BA1

The NM_000173.7(GP1BA):​c.1311_1349delAGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCC​(p.Glu438_Pro450del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★). Synonymous variant affecting the same amino acid position (i.e. P437P) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.79 (20002 hom., cov: 0)
  • Exomes 𝑓: 0.41 (110933 hom.)
  • Failed GnomAD Quality Control
• Consequence: GP1BA NM_000173.7 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:4 O:1
• Conservation: PhyloP100: 1.08
• Publications: 3 publications found

Genes affected

GP1BA (HGNC:4439): (glycoprotein Ib platelet subunit alpha) Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy. [provided by RefSeq, Oct 2013]

CHRNE (HGNC:1966): (cholinergic receptor nicotinic epsilon subunit) Acetylcholine receptors at mature mammalian neuromuscular junctions are pentameric protein complexes composed of four subunits in the ratio of two alpha subunits to one beta, one epsilon, and one delta subunit. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. Mutations in the epsilon subunit are associated with congenital myasthenic syndrome. [provided by RefSeq, Sep 2009]

CHRNE Gene-Disease associations (from GenCC):

• congenital myasthenic syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: Illumina
• congenital myasthenic syndrome 4A

  Inheritance: AD, AR Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), PanelApp Australia
• congenital myasthenic syndrome 4B

  Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), PanelApp Australia
• congenital myasthenic syndrome 4C

  Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
• postsynaptic congenital myasthenic syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000173.7.
• BP6: Variant 17-4933876-GGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCCA-G is Benign according to our data. Variant chr17-4933876-GGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCCA-G is described in ClinVar as Benign. ClinVar VariationId is 255466.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.808 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000173.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GP1BA	NM_000173.7	MANE Select	c.1311_1349delAGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCC	p.Glu438_Pro450del	disruptive_inframe_deletion	Exon 2 of 2	NP_000164.5

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GP1BA	ENST00000329125.6	TSL:1 MANE Select	c.1311_1349delAGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCC	p.Glu438_Pro450del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000329380.5
	CHRNE	ENST00000649830.1		c.-888+427_-888+465delTGGGGTGGTCGGGCTGGGGGCGGGCTCTGAGGTGGGCTC		intron	N/A	ENSP00000496907.1

Frequencies

GnomAD3 genomes AF: 0.794 AC: 51619 AN: 65030 Hom.: 20005 Cov.: 0

Gnomad AFR AF: 0.800

Gnomad AMI AF: 0.823

Gnomad AMR AF: 0.787

Gnomad ASJ AF: 0.770

Gnomad EAS AF: 0.600

Gnomad SAS AF: 0.631

Gnomad FIN AF: 0.741

Gnomad MID AF: 0.754

Gnomad NFE AF: 0.815

Gnomad OTH AF: 0.783

GnomAD2 exomes AF: 0.314 AC: 38907 AN: 123944 AF XY: 0.289

Gnomad AFR exome AF: 0.500

Gnomad AMR exome AF: 0.448

Gnomad ASJ exome AF: 0.176

Gnomad EAS exome AF: 0.421

Gnomad FIN exome AF: 0.230

Gnomad NFE exome AF: 0.308

Gnomad OTH exome AF: 0.381

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.413 AC: 317272 AN: 767336 Hom.: 110933 AF XY: 0.427 AC XY: 168203 AN XY: 393576

African (AFR) AF: 0.384 AC: 7665 AN: 19944

American (AMR) AF: 0.440 AC: 12707 AN: 28894

Ashkenazi Jewish (ASJ) AF: 0.491 AC: 9219 AN: 18770

East Asian (EAS) AF: 0.552 AC: 12560 AN: 22764

South Asian (SAS) AF: 0.417 AC: 23096 AN: 55436

European-Finnish (FIN) AF: 0.638 AC: 23132 AN: 36260

Middle Eastern (MID) AF: 0.476 AC: 1336 AN: 2808

European-Non Finnish (NFE) AF: 0.384 AC: 209390 AN: 545924

Other (OTH) AF: 0.497 AC: 18167 AN: 36536

GnomAD4 genome AF: 0.794 AC: 51618 AN: 65050 Hom.: 20002 Cov.: 0 AF XY: 0.786 AC XY: 23304 AN XY: 29644

African (AFR) AF: 0.798 AC: 10396 AN: 13022

American (AMR) AF: 0.787 AC: 4541 AN: 5770

Ashkenazi Jewish (ASJ) AF: 0.770 AC: 1418 AN: 1842

East Asian (EAS) AF: 0.600 AC: 1150 AN: 1916

South Asian (SAS) AF: 0.632 AC: 970 AN: 1536

European-Finnish (FIN) AF: 0.741 AC: 2257 AN: 3046

Middle Eastern (MID) AF: 0.750 AC: 81 AN: 108

European-Non Finnish (NFE) AF: 0.815 AC: 29799 AN: 36546

Other (OTH) AF: 0.780 AC: 624 AN: 800

Alfa AF: 0.148 Hom.: 3

ClinVar

Significance: Benign

Submissions summary: Benign:4 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

May 04, 2021

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Sep 11, 2018

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

not specified Benign:1

Jun 19, 2017

Genetic Services Laboratory, University of Chicago

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

GP1BA-related disorder Benign:1

Jan 28, 2024

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).

CIC-rearranged sarcoma Other:1

Children's Cancer Therapy Development Institute

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1
Mutation Taster		=187/13	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs770991996; hg19: chr17-4837171; COSMIC: COSV56701188; COSMIC: COSV56701188;