rs771282640

Positions:

• chr7-246502-G-GGACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGC
• chr7-246502-G-GGACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCGACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGC

Variant summary

Our verdict is Benign. Variant got -15 ACMG points: 1P and 16B. PP3 BP6_Very_Strong BA1

The NM_020223.4(FAM20C):​c.953_956+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG variant causes a intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.283 in 1,341,114 control chromosomes in the GnomAD database, including 72,792 homozygotes. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.40 (6675 hom., cov: 40)
  • Exomes 𝑓: 0.27 (66117 hom.)
• Consequence: FAM20C NM_020223.4 intron
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:7
• Conservation: PhyloP100: 8.67

Genes affected

FAM20C (HGNC:22140): (FAM20C golgi associated secretory pathway kinase) This gene encodes a member of the family of secreted protein kinases. The encoded protein binds calcium and phosphorylates proteins involved in bone mineralization. Mutations in this gene are associated with the autosomal recessive disorder Raine syndrome. [provided by RefSeq, Apr 2014]

FAM20C (HGNC:):

ACMG classification

Verdict is Benign. Variant got -15 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• BP6: Variant 7-246502-G-GGACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGC is Benign according to our data. Variant chr7-246502-G-GGACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGC is described in ClinVar as [Benign]. Clinvar id is 402845.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.46 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FAM20C	NM_020223.4	c.953_956+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG		intron_variant		ENST00000313766.6	NP_064608.2
FAM20C	XR_001744837.2	n.1503_1506+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG		intron_variant
FAM20C	XR_007060116.1	n.1582_1585+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG		intron_variant
FAM20C	XR_007060117.1	n.1503_1506+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FAM20C	ENST00000313766.6	c.953_956+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG		intron_variant		1	NM_020223.4	ENSP00000322323.5
FAM20C	ENST00000515795.1	n.610_613+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG		intron_variant		1

Frequencies

GnomAD3 genomes AF: 0.397 AC: 43540 AN: 109688 Hom.: 6672 Cov.: 40

Gnomad AFR AF: 0.467

Gnomad AMI AF: 0.491

Gnomad AMR AF: 0.327

Gnomad ASJ AF: 0.379

Gnomad EAS AF: 0.447

Gnomad SAS AF: 0.317

Gnomad FIN AF: 0.349

Gnomad MID AF: 0.489

Gnomad NFE AF: 0.391

Gnomad OTH AF: 0.401

GnomAD4 exome AF: 0.273 AC: 335863 AN: 1231342 Hom.: 66117 Cov.: 34 AF XY: 0.274 AC XY: 167017 AN XY: 610540

Gnomad4 AFR exome AF: 0.244

Gnomad4 AMR exome AF: 0.204

Gnomad4 ASJ exome AF: 0.268

Gnomad4 EAS exome AF: 0.366

Gnomad4 SAS exome AF: 0.236

Gnomad4 FIN exome AF: 0.270

Gnomad4 NFE exome AF: 0.275

Gnomad4 OTH exome AF: 0.289

GnomAD4 genome AF: 0.397 AC: 43564 AN: 109772 Hom.: 6675 Cov.: 40 AF XY: 0.393 AC XY: 21057 AN XY: 53590

Gnomad4 AFR AF: 0.468

Gnomad4 AMR AF: 0.327

Gnomad4 ASJ AF: 0.379

Gnomad4 EAS AF: 0.447

Gnomad4 SAS AF: 0.317

Gnomad4 FIN AF: 0.349

Gnomad4 NFE AF: 0.391

Gnomad4 OTH AF: 0.395

Alfa AF: 0.204 Hom.: 843

ClinVar

Significance: Benign

Submissions summary: Benign:7

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:4

Benign, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 31, 2024	- -
Benign, criteria provided, single submitter	clinical testing	GeneDx	Apr 13, 2021	- -
Likely benign, no assertion criteria provided	clinical testing	Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC)	-	- -
Likely benign, no assertion criteria provided	clinical testing	Genome Diagnostics Laboratory, University Medical Center Utrecht	-	- -

not specified Benign:1

Benign, criteria provided, single submitter

clinical testing

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Mar 29, 2016

Variant identified in a genome or exome case(s) and assessed due to predicted null impact of the variant or pathogenic assertions in the literature or databases. Disclaimer: This variant has not undergone full assessment. The following are preliminary notes: ExAC frequency -

FAM20C-related disorder Benign:1

Benign, no assertion criteria provided

clinical testing

PreventionGenetics, part of Exact Sciences

Mar 03, 2021

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Lethal osteosclerotic bone dysplasia Benign:1

Benign, criteria provided, single submitter

clinical testing

Mendelics

May 28, 2019

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs771282640; hg19: chr7-286468;