rs774676466

Variant names:

• chr17-30237266-AGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGG-A
• rs774676466
• ENST00000855095.1:c.-124+1078_-124+1120delCCCCAGCATCTCCCCTGCACCCCCAGCATCCCCCCTGCAGCCC

Your query was ambiguous. Multiple possible variants found:

• chr17-30237266-AGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGG-A
• chr17-30237266-AGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGG-AGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGG

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The ENST00000855095.1(SLC6A4):​c.-124+1078_-124+1120delCCCCAGCATCTCCCCTGCACCCCCAGCATCCCCCCTGCAGCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.28 (2026 hom., cov: 0)
  • Failed GnomAD Quality Control
• Consequence: SLC6A4 ENST00000855095.1 intron
• Clinical Significance: Likely benign criteria provided, single submitter P:1 B:1
• Conservation: PhyloP100: 1.68
• Publications: 6 publications found

Genes affected

SLC6A4 (HGNC:11050): (solute carrier family 6 member 4) This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake. There have been conflicting results in the literature about the possible effect, if any, that this polymorphism may play in behavior and depression. [provided by RefSeq, May 2019]

SLC6A4 Gene-Disease associations (from GenCC):

• obsessive-compulsive disorder

  Inheritance: AD Classification: LIMITED Submitted by: PanelApp Australia
• autism spectrum disorder

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000266120 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 17-30237266-AGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGG-A is Benign according to our data. Variant chr17-30237266-AGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGG-A is described in ClinVar as Likely_benign. ClinVar VariationId is 12934.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000855095.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
There are no transcript annotations for this variant.

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC6A4	ENST00000855095.1		c.-124+1078_-124+1120delCCCCAGCATCTCCCCTGCACCCCCAGCATCCCCCCTGCAGCCC		intron	N/A	ENSP00000525154.1
	SLC6A4	ENST00000855096.1		c.-221+1078_-221+1120delCCCCAGCATCTCCCCTGCACCCCCAGCATCCCCCCTGCAGCCC		intron	N/A	ENSP00000525155.1
	ENSG00000266120	ENST00000724731.1		n.109+197_109+239delGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGGAGATGCTGGGG		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.283 AC: 11592 AN: 40946 Hom.: 2032 Cov.: 0

Gnomad AFR AF: 0.145

Gnomad AMI AF: 0.199

Gnomad AMR AF: 0.408

Gnomad ASJ AF: 0.422

Gnomad EAS AF: 0.595

Gnomad SAS AF: 0.466

Gnomad FIN AF: 0.277

Gnomad MID AF: 0.288

Gnomad NFE AF: 0.304

Gnomad OTH AF: 0.302

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.283 AC: 11581 AN: 40958 Hom.: 2026 Cov.: 0 AF XY: 0.284 AC XY: 5220 AN XY: 18372

African (AFR) AF: 0.145 AC: 1507 AN: 10372

American (AMR) AF: 0.408 AC: 1435 AN: 3514

Ashkenazi Jewish (ASJ) AF: 0.422 AC: 488 AN: 1156

East Asian (EAS) AF: 0.592 AC: 508 AN: 858

South Asian (SAS) AF: 0.463 AC: 311 AN: 672

European-Finnish (FIN) AF: 0.277 AC: 493 AN: 1780

Middle Eastern (MID) AF: 0.292 AC: 14 AN: 48

European-Non Finnish (NFE) AF: 0.304 AC: 6624 AN: 21804

Other (OTH) AF: 0.299 AC: 152 AN: 508

Alfa AF: 0.192 Hom.: 427

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	Autism spectrum disorder (1)
1	-	-	Serotonin transporter activity, increased/decreased (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs774676466;

hg19: chr17-28564284;