rs774995085

Variant names:

• chr2-63433783-TGGCTCTGTCCTTCTCAGAAGAAATGGG-T
• rs774995085
• NM_015910.7:c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4 BP6 BS2

The NM_015910.7(WDPCP):​c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC​(p.Pro254_Ala262del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000431 in 1,613,558 control chromosomes in the GnomAD database, including 2 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00034 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00044 (2 hom.)
• Consequence: WDPCP NM_015910.7 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:2
• Conservation: PhyloP100: 5.93
• Publications: 1 publications found

Genes affected

WDPCP (HGNC:28027): (WD repeat containing planar cell polarity effector) This gene encodes a cytoplasmic WD40 repeat protein. A similar gene in frogs encodes a planar cell polarity protein that plays a critical role in collective cell movement and ciliogenesis by mediating septin localization. Mutations in this gene are associated with Bardet-Biedl syndrome 15 and may also play a role in Meckel-Gruber syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

WDPCP Gene-Disease associations (from GenCC):

• Bardet-Biedl syndrome 15

  Inheritance: AR Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
• Bardet-Biedl syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• heart defect - tongue hamartoma - polysyndactyly syndrome

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_015910.7.
• BP6: Variant 2-63433783-TGGCTCTGTCCTTCTCAGAAGAAATGGG-T is Benign according to our data. Variant chr2-63433783-TGGCTCTGTCCTTCTCAGAAGAAATGGG-T is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 531819.
• BS2: High Homozygotes in GnomAdExome4 at 2 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_015910.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WDPCP	NM_015910.7	MANE Select	c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC	p.Pro254_Ala262del	conservative_inframe_deletion	Exon 9 of 18	NP_056994.3
	WDPCP	NM_001354044.2		c.688_714delCCCATTTCTTCTGAGAAGGACAGAGCC	p.Pro230_Ala238del	conservative_inframe_deletion	Exon 10 of 19	NP_001340973.1
	WDPCP	NM_001354045.2		c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC	p.Pro254_Ala262del	conservative_inframe_deletion	Exon 9 of 13	NP_001340974.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WDPCP	ENST00000272321.12	TSL:1 MANE Select	c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC	p.Pro254_Ala262del	conservative_inframe_deletion	Exon 9 of 18	ENSP00000272321.7
	WDPCP	ENST00000409562.7	TSL:1	c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC	p.Pro254_Ala262del	conservative_inframe_deletion	Exon 9 of 14	ENSP00000387222.3
	WDPCP	ENST00000398544.7	TSL:1	c.283_309delCCCATTTCTTCTGAGAAGGACAGAGCC	p.Pro95_Ala103del	conservative_inframe_deletion	Exon 3 of 12	ENSP00000381552.3

Frequencies

GnomAD3 genomes AF: 0.000335 AC: 51 AN: 152214 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000482

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000327

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0000941

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000632

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000297 AC: 74 AN: 248902 AF XY: 0.000267

Gnomad AFR exome AF: 0.0000646

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.0000995

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000638

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000441 AC: 645 AN: 1461344 Hom.: 2 AF XY: 0.000417 AC XY: 303 AN XY: 726920

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000896 AC: 3 AN: 33468

American (AMR) AF: 0.0000448 AC: 2 AN: 44678

Ashkenazi Jewish (ASJ) AF: 0.0000383 AC: 1 AN: 26122

East Asian (EAS) AF: 0.00 AC: 0 AN: 39692

South Asian (SAS) AF: 0.00 AC: 0 AN: 86128

European-Finnish (FIN) AF: 0.0000562 AC: 3 AN: 53396

Middle Eastern (MID) AF: 0.000173 AC: 1 AN: 5768

European-Non Finnish (NFE) AF: 0.000559 AC: 622 AN: 1111720

Other (OTH) AF: 0.000215 AC: 13 AN: 60372

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000335 AC: 51 AN: 152214 Hom.: 0 Cov.: 32 AF XY: 0.000269 AC XY: 20 AN XY: 74358

African (AFR) AF: 0.0000482 AC: 2 AN: 41466

American (AMR) AF: 0.000327 AC: 5 AN: 15270

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5200

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.0000941 AC: 1 AN: 10626

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.000632 AC: 43 AN: 68034

Other (OTH) AF: 0.00 AC: 0 AN: 2088

Alfa AF: 0.000391 Hom.: 0

Bravo AF: 0.000397

ClinVar

ClinVar submissions as Germline

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	Bardet-Biedl syndrome (1)
-	-	1	Inborn genetic diseases (1)
-	-	1	WDPCP-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.9
Mutation Taster		=31/169	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs774995085; hg19: chr2-63660917;