rs775583843

Variant names:

• chr6-52490338-CTTGGTTAAGGAGGTCAGTATGAAT-C
• rs775583843
• NM_018100.4:c.1841_1851+13delTGGTTAAGGAGGTCAGTATGAATT

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 2P and 6B. PVS1_Moderate BP6_Moderate BS2

The NM_018100.4(EFHC1):​c.1841_1851+13delTGGTTAAGGAGGTCAGTATGAATT​(p.Leu614CysfsTer20) variant causes a frameshift, splice donor, splice region, intron change. The variant allele was found at a frequency of 0.0000675 in 1,613,952 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.000072 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000067 (0 hom.)
• Consequence: EFHC1 NM_018100.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 4.70
• Publications: 0 publications found

Genes affected

EFHC1 (HGNC:16406): (EF-hand domain containing 1) This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]

EFHC1 Gene-Disease associations (from GenCC):

• juvenile myoclonic epilepsy

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• epilepsy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0426 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• BP6: Variant 6-52490338-CTTGGTTAAGGAGGTCAGTATGAAT-C is Benign according to our data. Variant chr6-52490338-CTTGGTTAAGGAGGTCAGTATGAAT-C is described in ClinVar as [Likely_benign]. Clinvar id is 411576.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 11 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EFHC1	NM_018100.4	c.1841_1851+13delTGGTTAAGGAGGTCAGTATGAATT	p.Leu614CysfsTer20	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 10 of 11	ENST00000371068.11	NP_060570.2
EFHC1	NM_001172420.2	c.1784_1794+13delTGGTTAAGGAGGTCAGTATGAATT	p.Leu595CysfsTer20	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 11 of 12		NP_001165891.1
EFHC1	NR_033327.2	n.3167_3177+13delTGGTTAAGGAGGTCAGTATGAATT		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	Exon 9 of 10

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EFHC1	ENST00000371068.11	c.1841_1851+13delTGGTTAAGGAGGTCAGTATGAATT	p.Leu614CysfsTer20	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 10 of 11	1	NM_018100.4	ENSP00000360107.4

Frequencies

GnomAD3 genomes AF: 0.0000723 AC: 11 AN: 152148 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000471

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000882

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000917 AC: 23 AN: 250924 AF XY: 0.0000959

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.000370

Gnomad NFE exome AF: 0.000132

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000670 AC: 98 AN: 1461686 Hom.: 0 AF XY: 0.0000633 AC XY: 46 AN XY: 727148

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000299 AC: 1 AN: 33470

American (AMR) AF: 0.00 AC: 0 AN: 44712

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26128

East Asian (EAS) AF: 0.00 AC: 0 AN: 39696

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.000262 AC: 14 AN: 53396

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000729 AC: 81 AN: 1111870

Other (OTH) AF: 0.0000331 AC: 2 AN: 60390

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000722 AC: 11 AN: 152266 Hom.: 0 Cov.: 32 AF XY: 0.0000537 AC XY: 4 AN XY: 74446

African (AFR) AF: 0.00 AC: 0 AN: 41560

American (AMR) AF: 0.00 AC: 0 AN: 15294

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5192

South Asian (SAS) AF: 0.00 AC: 0 AN: 4818

European-Finnish (FIN) AF: 0.000471 AC: 5 AN: 10606

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.0000882 AC: 6 AN: 68008

Other (OTH) AF: 0.00 AC: 0 AN: 2112

Alfa AF: 0.00 Hom.: 0

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Absence seizure;C1850778:Myoclonic epilepsy, juvenile, susceptibility to, 1 Benign:1

Aug 18, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.7
Mutation Taster		=55/145	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs775583843; hg19: chr6-52355136;