rs778840671

Variant summary

Our verdict is Benign. The variant received -7 ACMG points: 0P and 7B. BP3BP6_ModerateBS2

The NM_003924.4(PHOX2B):​c.747_773delAGCGGCGGCGGCGGCAGCGGCAGCGGC​(p.Ala250_Ala258del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000014 in 1,284,480 control chromosomes in the GnomAD database, including 2 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. A249A) has been classified as Likely benign.

Frequency

Genomes: 𝑓 0.000014 ( 0 hom., cov: 32)
Exomes 𝑓: 0.000014 ( 2 hom. )

Consequence

PHOX2B
NM_003924.4 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Likely benign criteria provided, single submitter B:1

Conservation

PhyloP100: 3.23

Publications

0 publications found
Variant links:
Genes affected
PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]
PHOX2B Gene-Disease associations (from GenCC):
  • central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
  • Haddad syndrome
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
  • neuroblastoma, susceptibility to, 2
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
  • congenital central hypoventilation syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Benign. The variant received -7 ACMG points.

BP3
Nonframeshift variant in repetitive region in NM_003924.4
BP6
Variant 4-41745978-CGCCGCTGCCGCTGCCGCCGCCGCCGCT-C is Benign according to our data. Variant chr4-41745978-CGCCGCTGCCGCTGCCGCCGCCGCCGCT-C is described in ClinVar as Likely_benign. ClinVar VariationId is 413924.Status of the report is criteria_provided_single_submitter, 1 stars.
BS2
High AC in GnomAdExome4 at 16 AD gene.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PHOX2BNM_003924.4 linkc.747_773delAGCGGCGGCGGCGGCAGCGGCAGCGGC p.Ala250_Ala258del disruptive_inframe_deletion Exon 3 of 3 ENST00000226382.4 NP_003915.2 Q99453

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PHOX2BENST00000226382.4 linkc.747_773delAGCGGCGGCGGCGGCAGCGGCAGCGGC p.Ala250_Ala258del disruptive_inframe_deletion Exon 3 of 3 1 NM_003924.4 ENSP00000226382.2 Q99453
PHOX2BENST00000510424.2 linkn.*28_*54delAGCGGCGGCGGCGGCAGCGGCAGCGGC downstream_gene_variant 3

Frequencies

GnomAD3 genomes
AF:
0.0000136
AC:
2
AN:
147158
Hom.:
0
Cov.:
32
show subpopulations
Gnomad AFR
AF:
0.00
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.00
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.000214
Gnomad SAS
AF:
0.000211
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.00
Gnomad OTH
AF:
0.00
GnomAD2 exomes
AF:
0.0000373
AC:
2
AN:
53582
AF XY:
0.0000623
show subpopulations
Gnomad AFR exome
AF:
0.00
Gnomad AMR exome
AF:
0.00
Gnomad ASJ exome
AF:
0.00
Gnomad EAS exome
AF:
0.00
Gnomad FIN exome
AF:
0.00
Gnomad NFE exome
AF:
0.00
Gnomad OTH exome
AF:
0.00
GnomAD4 exome
AF:
0.0000141
AC:
16
AN:
1137216
Hom.:
2
AF XY:
0.0000109
AC XY:
6
AN XY:
549542
show subpopulations
African (AFR)
AF:
0.0000429
AC:
1
AN:
23324
American (AMR)
AF:
0.0000970
AC:
1
AN:
10310
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
16748
East Asian (EAS)
AF:
0.00
AC:
0
AN:
24548
South Asian (SAS)
AF:
0.000203
AC:
6
AN:
29522
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
31772
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
3278
European-Non Finnish (NFE)
AF:
0.00000735
AC:
7
AN:
952776
Other (OTH)
AF:
0.0000223
AC:
1
AN:
44938
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.538
Heterozygous variant carriers
0
1
1
2
2
3
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
AF:
0.0000136
AC:
2
AN:
147264
Hom.:
0
Cov.:
32
AF XY:
0.0000279
AC XY:
2
AN XY:
71700
show subpopulations
African (AFR)
AF:
0.00
AC:
0
AN:
40906
American (AMR)
AF:
0.00
AC:
0
AN:
14632
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
3418
East Asian (EAS)
AF:
0.000215
AC:
1
AN:
4652
South Asian (SAS)
AF:
0.000211
AC:
1
AN:
4736
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
9374
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
274
European-Non Finnish (NFE)
AF:
0.00
AC:
0
AN:
66316
Other (OTH)
AF:
0.00
AC:
0
AN:
2046
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.525
Heterozygous variant carriers
0
1
1
2
2
3
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Genome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
Alfa
AF:
0.00
Hom.:
0
Bravo
AF:
0.00000378

ClinVar

Significance: Likely benign
Submissions summary: Benign:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Haddad syndrome Benign:1
Sep 01, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
3.2
Mutation Taster
=193/7
polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs778840671; hg19: chr4-41747995; API