rs779637348

Variant names:

• chr6-139373408-AGAGCCGCCGGGGGTGCTGCTGCCGCCC-A
• rs779637348
• NM_006079.5:c.510_536delGGGCGGCAGCAGCACCCCCGGCGGCTC

Your query was ambiguous. Multiple possible variants found:

• chr6-139373408-AGAGCCGCCGGGGGTGCTGCTGCCGCCC-A
• chr6-139373408-AGAGCCGCCGGGGGTGCTGCTGCCGCCC-AGAGCCGCCGGGGGTGCTGCTGCCGCCCGAGCCGCCGGGGGTGCTGCTGCCGCCC

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP3 BS2_Supporting

The NM_006079.5(CITED2):​c.510_536delGGGCGGCAGCAGCACCCCCGGCGGCTC​(p.Gly171_Ser179del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000174 in 1,553,684 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. S170S) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.00018 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00017 (0 hom.)
• Consequence: CITED2 NM_006079.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter P:1 U:1
• Conservation: PhyloP100: 2.34
• Publications: 0 publications found

Genes affected

CITED2 (HGNC:1987): (Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2) The protein encoded by this gene inhibits transactivation of HIF1A-induced genes by competing with binding of hypoxia-inducible factor 1-alpha to p300-CH1. Mutations in this gene are a cause of cardiac septal defects. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]

CITED2 Gene-Disease associations (from GenCC):

• atrial septal defect 8

  Inheritance: AD Classification: MODERATE Submitted by: Laboratory for Molecular Medicine
• congenital heart defects, multiple types

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• congenital heart disease

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen
• ventricular septal defect 2

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000226571 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_006079.5
• BS2: High AC in GnomAd4 at 27 AD,Unknown gene. Variant has AC lower than other variant known as pathogenic in the gene, so the strength is limited to Supporting.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006079.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CITED2	NM_006079.5	MANE Select	c.510_536delGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Gly171_Ser179del	disruptive_inframe_deletion	Exon 2 of 2	NP_006070.2
	CITED2	NM_001168389.3		c.525_551delGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Gly176_Ser184del	disruptive_inframe_deletion	Exon 2 of 2	NP_001161861.2	A0A0A0MTM3
	CITED2	NM_001168388.3		c.510_536delGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Gly171_Ser179del	disruptive_inframe_deletion	Exon 2 of 2	NP_001161860.1	Q99967-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CITED2	ENST00000367651.4	TSL:1 MANE Select	c.510_536delGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Gly171_Ser179del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000356623.2	Q99967-1
	CITED2	ENST00000537332.2	TSL:3	c.525_551delGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Gly176_Ser184del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000444198.2	A0A0A0MTM3
	CITED2	ENST00000536159.2	TSL:3	c.510_536delGGGCGGCAGCAGCACCCCCGGCGGCTC	p.Gly171_Ser179del	disruptive_inframe_deletion	Exon 2 of 2	ENSP00000442831.1	Q99967-1

Frequencies

GnomAD3 genomes AF: 0.000180 AC: 27 AN: 150200 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000491

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000397

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000198

Gnomad SAS AF: 0.000636

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000193

Gnomad OTH AF: 0.000970

GnomAD2 exomes AF: 0.000142 AC: 27 AN: 190406 AF XY: 0.0000943

Gnomad AFR exome AF: 0.0000980

Gnomad AMR exome AF: 0.000351

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000146

Gnomad FIN exome AF: 0.000105

Gnomad NFE exome AF: 0.000125

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000173 AC: 243 AN: 1403372 Hom.: 0 AF XY: 0.000176 AC XY: 123 AN XY: 697184

African (AFR) AF: 0.000200 AC: 6 AN: 29942

American (AMR) AF: 0.000328 AC: 12 AN: 36530

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 22886

East Asian (EAS) AF: 0.000137 AC: 5 AN: 36372

South Asian (SAS) AF: 0.000181 AC: 14 AN: 77330

European-Finnish (FIN) AF: 0.0000407 AC: 2 AN: 49184

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5544

European-Non Finnish (NFE) AF: 0.000176 AC: 192 AN: 1087892

Other (OTH) AF: 0.000208 AC: 12 AN: 57692

GnomAD4 genome AF: 0.000180 AC: 27 AN: 150312 Hom.: 0 Cov.: 32 AF XY: 0.000191 AC XY: 14 AN XY: 73438

African (AFR) AF: 0.0000489 AC: 2 AN: 40868

American (AMR) AF: 0.000397 AC: 6 AN: 15126

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3458

East Asian (EAS) AF: 0.000198 AC: 1 AN: 5044

South Asian (SAS) AF: 0.000636 AC: 3 AN: 4716

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10366

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 278

European-Non Finnish (NFE) AF: 0.000193 AC: 13 AN: 67468

Other (OTH) AF: 0.000960 AC: 2 AN: 2084

Alfa AF: 0.0000965 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)
1	-	-	Ventricular septal defect 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.3
Mutation Taster		=146/54	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs779637348; hg19: chr6-139694545;