rs781355841

Variant names:

• chr6-45422681-ACAGCAGCAGCAACAGCAGCAGCAGCAACAG-A
• NM_001024630.4:c.159_188delACAGCAGCAGCAGCAACAGCAGCAGCAGCA

Your query was ambiguous. Multiple possible variants found:

• chr6-45422681-ACAGCAGCAGCAACAGCAGCAGCAGCAACAG-A
• chr6-45422681-ACAGCAGCAGCAACAGCAGCAGCAGCAACAG-ACAGCAGCAGCAACAG
• chr6-45422681-ACAGCAGCAGCAACAGCAGCAGCAGCAACAG-ACAGCAGCAGCAACAGCAGCAGCAGCAACAGCAGCAGCAGCAACAG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001024630.4(RUNX2):​c.159_188delACAGCAGCAGCAGCAACAGCAGCAGCAGCA​(p.Gln54_Gln63del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000689 in 1,450,906 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q53Q) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 30)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: RUNX2 NM_001024630.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.14

Genes affected

RUNX2 (HGNC:10472): (RUNX family transcription factor 2) This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RUNX2	NM_001024630.4	c.159_188delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln54_Gln63del	disruptive_inframe_deletion	Exon 3 of 9	ENST00000647337.2	NP_001019801.3
RUNX2	NM_001369405.1	c.117_146delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln40_Gln49del	disruptive_inframe_deletion	Exon 1 of 7		NP_001356334.1
RUNX2	NM_001015051.4	c.159_188delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln54_Gln63del	disruptive_inframe_deletion	Exon 3 of 8		NP_001015051.3
RUNX2	NM_001278478.2	c.117_146delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln40_Gln49del	disruptive_inframe_deletion	Exon 1 of 6		NP_001265407.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RUNX2	ENST00000647337.2	c.159_188delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln54_Gln63del	disruptive_inframe_deletion	Exon 3 of 9		NM_001024630.4	ENSP00000495497.1

Frequencies

GnomAD3 genomes Cov.: 30

GnomAD4 exome AF: 6.89e-7 AC: 1 AN: 1450906 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 721666

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.03e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 30

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr6-45390418;