rs781355841

Variant names:

• chr6-45422681-ACAGCAGCAGCAACAGCAGCAGCAGCAACAG-A
• rs781355841
• NM_001024630.4:c.159_188delACAGCAGCAGCAGCAACAGCAGCAGCAGCA

Your query was ambiguous. Multiple possible variants found:

• chr6-45422681-ACAGCAGCAGCAACAGCAGCAGCAGCAACAG-A
• chr6-45422681-ACAGCAGCAGCAACAGCAGCAGCAGCAACAG-ACAGCAGCAGCAACAG
• chr6-45422681-ACAGCAGCAGCAACAGCAGCAGCAGCAACAG-ACAGCAGCAGCAACAGCAGCAGCAGCAACAGCAGCAGCAGCAACAG

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001024630.4(RUNX2):​c.159_188delACAGCAGCAGCAGCAACAGCAGCAGCAGCA​(p.Gln54_Gln63del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000689 in 1,450,906 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q53Q) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 30)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: RUNX2 NM_001024630.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.14
• Publications: 0 publications found

Genes affected

RUNX2 (HGNC:10472): (RUNX family transcription factor 2) This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]

RUNX2 Gene-Disease associations (from GenCC):

• cleidocranial dysplasia 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
• metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001024630.4

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001024630.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RUNX2	NM_001024630.4	MANE Select	c.159_188delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln54_Gln63del	disruptive_inframe_deletion	Exon 3 of 9	NP_001019801.3	Q13950-1
	RUNX2	NM_001369405.1		c.117_146delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln40_Gln49del	disruptive_inframe_deletion	Exon 1 of 7	NP_001356334.1	Q13950-2
	RUNX2	NM_001015051.4		c.159_188delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln54_Gln63del	disruptive_inframe_deletion	Exon 3 of 8	NP_001015051.3	Q13950-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RUNX2	ENST00000647337.2	MANE Select	c.159_188delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln54_Gln63del	disruptive_inframe_deletion	Exon 3 of 9	ENSP00000495497.1	Q13950-1
	RUNX2	ENST00000359524.7	TSL:1	c.117_146delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln40_Gln49del	disruptive_inframe_deletion	Exon 1 of 7	ENSP00000352514.5	Q13950-2
	RUNX2	ENST00000625924.1	TSL:1	c.117_146delACAGCAGCAGCAGCAACAGCAGCAGCAGCA	p.Gln40_Gln49del	disruptive_inframe_deletion	Exon 1 of 6	ENSP00000485863.1	A0A0D9SEN7

Frequencies

GnomAD3 genomes Cov.: 30

GnomAD4 exome AF: 6.89e-7 AC: 1 AN: 1450906 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 721666

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32806

American (AMR) AF: 0.00 AC: 0 AN: 43422

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25900

East Asian (EAS) AF: 0.00 AC: 0 AN: 38612

South Asian (SAS) AF: 0.00 AC: 0 AN: 84858

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52124

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5742

European-Non Finnish (NFE) AF: 9.03e-7 AC: 1 AN: 1107500

Other (OTH) AF: 0.00 AC: 0 AN: 59942

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 30

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs781355841; hg19: chr6-45390418;