rs78379807

Positions:

• chr3-48467261-G-GGCCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGAT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_033629.6(TREX1):​c.609_662dupCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGATGC​(p.Ala221_His222insLeuLeuSerIleCysGlnTrpArgProGlnAlaLeuLeuArgTrpValAspAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TREX1 NM_033629.6 disruptive_inframe_insertion
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 0.434

Genes affected

TREX1 (HGNC:12269): (three prime repair exonuclease 1) This gene encodes a nuclear protein with 3' exonuclease activity. The encoded protein may play a role in DNA repair and serve as a proofreading function for DNA polymerase. Mutations in this gene result in Aicardi-Goutieres syndrome, chilblain lupus, Cree encephalitis, and other diseases of the immune system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]

ATRIP (HGNC:33499): (ATR interacting protein) This gene encodes an essential component of the DNA damage checkpoint. The encoded protein binds to single-stranded DNA coated with replication protein A. The protein also interacts with the ataxia telangiectasia and Rad3 related protein kinase, resulting in its accumulation at intranuclear foci induced by DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]

ATRIP-TREX1 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_033629.6.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TREX1	NM_033629.6	c.609_662dupCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGATGC	p.Ala221_His222insLeuLeuSerIleCysGlnTrpArgProGlnAlaLeuLeuArgTrpValAspAla	disruptive_inframe_insertion	2/2	ENST00000625293.3	NP_338599.1
ATRIP	NM_130384.3	c.*1710_*1763dupCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGATGC		3_prime_UTR_variant	13/13	ENST00000320211.10	NP_569055.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TREX1	ENST00000625293.3	c.609_662dupCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGATGC	p.Ala221_His222insLeuLeuSerIleCysGlnTrpArgProGlnAlaLeuLeuArgTrpValAspAla	disruptive_inframe_insertion	2/2	6	NM_033629.6	ENSP00000486676.2
ATRIP	ENST00000320211.10	c.*1710_*1763dupCCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGATGC		3_prime_UTR_variant	13/13	1	NM_130384.3	ENSP00000323099.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 33

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Aicardi-Goutieres syndrome 1 Other:1

not provided, no classification provided

literature only

GeneReviews

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs78379807; hg19: chr3-48508660;