rs786204010

Variant names:

• chr1-11801333-A-AGGGTCACCTGCTGGGTGCCAGGTCACGTCTATGTAGAGG
• rs786204010
• NM_005957.5:c.264_302dupCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCC

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM2 PM4 PP3 PP5_Moderate

The NM_005957.5(MTHFR):​c.264_302dupCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCC​(p.Pro101_Gly102insLeuTyrIleAspValThrTrpHisProAlaGlyAspPro) variant causes a disruptive inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MTHFR NM_005957.5 disruptive_inframe_insertion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 9.20

Genes affected

MTHFR (HGNC:7436): (methylenetetrahydrofolate reductase) The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_005957.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 1-11801333-A-AGGGTCACCTGCTGGGTGCCAGGTCACGTCTATGTAGAGG is Pathogenic according to our data. Variant chr1-11801333-A-AGGGTCACCTGCTGGGTGCCAGGTCACGTCTATGTAGAGG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 187871.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MTHFR	NM_005957.5	c.264_302dupCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCC	p.Pro101_Gly102insLeuTyrIleAspValThrTrpHisProAlaGlyAspPro	disruptive_inframe_insertion	Exon 3 of 12	ENST00000376590.9	NP_005948.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MTHFR	ENST00000376590.9	c.264_302dupCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCC	p.Pro101_Gly102insLeuTyrIleAspValThrTrpHisProAlaGlyAspPro	disruptive_inframe_insertion	Exon 3 of 12	1	NM_005957.5	ENSP00000365775.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 6.84e-7 AC: 1 AN: 1461884 Hom.: 0 Cov.: 31 AF XY: 0.00000138 AC XY: 1 AN XY: 727242

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 8.99e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Homocystinuria due to methylene tetrahydrofolate reductase deficiency Pathogenic:2

Nov 12, 2021

MGZ Medical Genetics Center

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

-

University Children's Hospital, University of Zurich

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs786204010; hg19: chr1-11861390;