rs786204550

Variant names:

• chr17-3648904-TATTACTATCCTTGAGCTCCCC-T
• rs786204550
• NM_004937.3:c.199_219delATTACTATCCTTGAGCTCCCC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_004937.3(CTNS):​c.199_219delATTACTATCCTTGAGCTCCCC​(p.Ile67_Pro73del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CTNS NM_004937.3 conservative_inframe_deletion
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 5.93
• Publications: 0 publications found

Genes affected

CTNS (HGNC:2518): (cystinosin, lysosomal cystine transporter) This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]

CTNS Gene-Disease associations (from GenCC):

• cystinosis

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• nephropathic cystinosis

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, G2P
• juvenile nephropathic cystinosis

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• ocular cystinosis

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• nephropathic infantile cystinosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

LOC105371493 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_004937.3.
• PP5: Variant 17-3648904-TATTACTATCCTTGAGCTCCCC-T is Pathogenic according to our data. Variant chr17-3648904-TATTACTATCCTTGAGCTCCCC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 188906.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CTNS	NM_004937.3	c.199_219delATTACTATCCTTGAGCTCCCC	p.Ile67_Pro73del	conservative_inframe_deletion	Exon 5 of 12	ENST00000046640.9	NP_004928.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CTNS	ENST00000046640.9	c.199_219delATTACTATCCTTGAGCTCCCC	p.Ile67_Pro73del	conservative_inframe_deletion	Exon 5 of 12	1	NM_004937.3	ENSP00000046640.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Nephropathic cystinosis Pathogenic:1

Jul 31, 2014

Counsyl

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786204550; hg19: chr17-3552198;