rs786204550
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP5
The NM_004937.3(CTNS):c.199_219delATTACTATCCTTGAGCTCCCC(p.Ile67_Pro73del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).
Frequency
Consequence
NM_004937.3 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- cystinosisInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women's Health, ClinGen
- nephropathic cystinosisInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, Ambry Genetics
- juvenile nephropathic cystinosisInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, Labcorp Genetics (formerly Invitae)
- ocular cystinosisInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- nephropathic infantile cystinosisInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004937.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CTNS | MANE Select | c.199_219delATTACTATCCTTGAGCTCCCC | p.Ile67_Pro73del | conservative_inframe_deletion | Exon 5 of 12 | NP_004928.2 | O60931-1 | ||
| CTNS | c.199_219delATTACTATCCTTGAGCTCCCC | p.Ile67_Pro73del | conservative_inframe_deletion | Exon 5 of 13 | NP_001026851.2 | O60931-2 | |||
| CTNS | c.199_219delATTACTATCCTTGAGCTCCCC | p.Ile67_Pro73del | conservative_inframe_deletion | Exon 5 of 13 | NP_001361421.1 | O60931-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CTNS | TSL:1 MANE Select | c.199_219delATTACTATCCTTGAGCTCCCC | p.Ile67_Pro73del | conservative_inframe_deletion | Exon 5 of 12 | ENSP00000046640.4 | O60931-1 | ||
| CTNS | TSL:1 | c.199_219delATTACTATCCTTGAGCTCCCC | p.Ile67_Pro73del | conservative_inframe_deletion | Exon 5 of 13 | ENSP00000371294.3 | O60931-2 | ||
| CTNS | c.199_219delATTACTATCCTTGAGCTCCCC | p.Ile67_Pro73del | conservative_inframe_deletion | Exon 5 of 12 | ENSP00000500995.1 | O60931-1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.