rs786205019

Variant names:

• chrX-154030644-CTCTCGGGCTCAGGTGGAGGT-TGCTCAAGTCCTGGGGCTCAG
• rs786205019
• NM_001110792.2:c.1200_1220delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001110792.2(MECP2):​c.1200_1220delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA​(p.ProProProGluProGluSer401*) variant causes a stop gained change. It is difficult to determine the true allele frequency of this variant because it is of type MNV, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P400P) has been classified as Benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 16)
• Consequence: MECP2 NM_001110792.2 stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:3
• Conservation: PhyloP100: 5.37
• Publications: 15 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant X-154030644-CTCTCGGGCTCAGGTGGAGGT-TGCTCAAGTCCTGGGGCTCAG is Pathogenic according to our data. Variant chrX-154030644-CTCTCGGGCTCAGGTGGAGGT-TGCTCAAGTCCTGGGGCTCAG is described in ClinVar as Pathogenic. ClinVar VariationId is 189665.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	NM_001110792.2	MANE Select	c.1200_1220delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA	p.ProProProGluProGluSer401*	stop_gained	N/A	NP_001104262.1
	MECP2	NM_004992.4	MANE Plus Clinical	c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA	p.ProProProGluProGluSer389*	stop_gained	N/A	NP_004983.1
	MECP2	NM_001316337.2		c.885_905delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA	p.ProProProGluProGluSer296*	stop_gained	N/A	NP_001303266.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	ENST00000453960.7	TSL:1 MANE Select	c.1200_1220delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA	p.ProProProGluProGluSer401*	stop_gained	N/A	ENSP00000395535.2
	MECP2	ENST00000303391.11	TSL:1 MANE Plus Clinical	c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA	p.ProProProGluProGluSer389*	stop_gained	N/A	ENSP00000301948.6
	MECP2	ENST00000630151.3	TSL:5	c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA	p.ProProProGluProGluSer389*	stop_gained	N/A	ENSP00000486089.2

Frequencies

GnomAD3 genomes Cov.: 16

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 16

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
2	-	-	Rett syndrome (2)
1	-	-	Attention deficit hyperactivity disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786205019; hg19: chrX-153296095;