rs786205082

Variant names:

• chr2-71664417-G-GACTCCCACAGACCTACTGTGTGT
• rs786205082
• ENST00000410020.8:c.5104_5105insGTACTCCCACAGACCTACTGTGT

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The ENST00000410020.8(DYSF):​c.5104_5105insGTACTCCCACAGACCTACTGTGT​(p.Val1702TyrfsTer43) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. V1702V) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: DYSF ENST00000410020.8 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: -0.0570
• Publications: 0 publications found

Genes affected

DYSF (HGNC:3097): (dysferlin) The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]

DYSF Gene-Disease associations (from GenCC):

• autosomal recessive limb-girdle muscular dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• neuromuscular disease caused by qualitative or quantitative defects of dysferlin

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• autosomal recessive limb-girdle muscular dystrophy type 2B

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• distal myopathy with anterior tibial onset

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• congenital myopathy, Paradas type

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Miyoshi myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-71664417-G-GACTCCCACAGACCTACTGTGTGT is Pathogenic according to our data. Variant chr2-71664417-G-GACTCCCACAGACCTACTGTGTGT is described in ClinVar as Pathogenic. ClinVar VariationId is 6670.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000410020.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DYSF	NM_001130987.2	MANE Select	c.5156_5174+4dupTCCCACAGACCTACTGTGTGTAC		splice_region intron	N/A	NP_001124459.1
	DYSF	NM_003494.4	MANE Plus Clinical	c.5039_5057+4dupTCCCACAGACCTACTGTGTGTAC		splice_region intron	N/A	NP_003485.1
	DYSF	NM_001130981.2		c.5153_5171+4dupTCCCACAGACCTACTGTGTGTAC		splice_region intron	N/A	NP_001124453.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DYSF	ENST00000410020.8	TSL:1 MANE Select	c.5104_5105insGTACTCCCACAGACCTACTGTGT	p.Val1702TyrfsTer43	frameshift	Exon 46 of 56	ENSP00000386881.3
	DYSF	ENST00000258104.8	TSL:1 MANE Plus Clinical	c.4987_4988insGTACTCCCACAGACCTACTGTGT	p.Val1663TyrfsTer43	frameshift	Exon 45 of 55	ENSP00000258104.3
	DYSF	ENST00000409582.7	TSL:1	c.5101_5102insGTACTCCCACAGACCTACTGTGT	p.Val1701TyrfsTer43	frameshift	Exon 46 of 56	ENSP00000386547.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Autosomal recessive limb-girdle muscular dystrophy type 2B (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.057
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786205082; hg19: chr2-71891547;