rs786205638
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_025000.4(DCAF17):c.459-7_499delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA(p.Tyr154fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R153R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_025000.4 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Woodhouse-Sakati syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Genomics England PanelApp, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet, G2P
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_025000.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DCAF17 | MANE Select | c.459-7_499delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA | p.Tyr154fs | frameshift splice_acceptor splice_region intron | Exon 5 of 14 | NP_079276.2 | Q5H9S7-1 | ||
| DCAF17 | c.459-7_499delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA | p.Tyr154fs | frameshift splice_acceptor splice_region intron | Exon 5 of 12 | NP_001158293.1 | F5H7W1 | |||
| DCAF17 | n.811-7_851delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA | splice_acceptor splice_region intron non_coding_transcript_exon | Exon 5 of 13 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DCAF17 | TSL:1 MANE Select | c.459-7_499delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA | p.Tyr154fs | frameshift splice_acceptor splice_region intron | Exon 5 of 14 | ENSP00000364404.3 | Q5H9S7-1 | ||
| DCAF17 | c.510-7_550delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA | p.Tyr171fs | frameshift splice_acceptor splice_region intron | Exon 6 of 15 | ENSP00000636727.1 | ||||
| DCAF17 | c.450-7_490delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA | p.Tyr151fs | frameshift splice_acceptor splice_region intron | Exon 5 of 14 | ENSP00000577692.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.