rs786205638

Variant names:

• chr2-171449871-TTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA-T
• rs786205638
• NM_025000.4:c.459-7_499delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_025000.4(DCAF17):​c.459-7_499delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA​(p.Tyr154fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R153R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: DCAF17 NM_025000.4 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.23
• Publications: 2 publications found

Genes affected

DCAF17 (HGNC:25784): (DDB1 and CUL4 associated factor 17) This gene encodes a nuclear transmembrane protein that associates with cullin 4A/damaged DNA binding protein 1 ubiquitin ligase complex. Mutations in this gene are associated with Woodhouse-Sakati syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]

DCAF17 Gene-Disease associations (from GenCC):

• Woodhouse-Sakati syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Genomics England PanelApp, Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-171449871-TTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA-T is Pathogenic according to our data. Variant chr2-171449871-TTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 191310.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_025000.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DCAF17	NM_025000.4	MANE Select	c.459-7_499delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA	p.Tyr154fs	frameshift splice_acceptor splice_region intron	Exon 5 of 14	NP_079276.2	Q5H9S7-1
	DCAF17	NM_001164821.2		c.459-7_499delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA	p.Tyr154fs	frameshift splice_acceptor splice_region intron	Exon 5 of 12	NP_001158293.1	F5H7W1
	DCAF17	NR_028482.2		n.811-7_851delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA		splice_acceptor splice_region intron non_coding_transcript_exon	Exon 5 of 13

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DCAF17	ENST00000375255.8	TSL:1 MANE Select	c.459-7_499delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA	p.Tyr154fs	frameshift splice_acceptor splice_region intron	Exon 5 of 14	ENSP00000364404.3	Q5H9S7-1
	DCAF17	ENST00000966668.1		c.510-7_550delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA	p.Tyr171fs	frameshift splice_acceptor splice_region intron	Exon 6 of 15	ENSP00000636727.1
	DCAF17	ENST00000907633.1		c.450-7_490delTTAAAAGATACTTGAGCTGGGACACTCCTCAAGAAGTCATTGCAGTTA	p.Tyr151fs	frameshift splice_acceptor splice_region intron	Exon 5 of 14	ENSP00000577692.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.2
Mutation Taster		=6/194	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786205638; hg19: chr2-172306381;