rs786205699

Positions:

• chr18-79988603-CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGT-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PM2 PP5_Very_Strong

The NM_001305563.2(TXNL4A):​c.-60-10936_-60-10903delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000128 in 414,754 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.00013 (0 hom., cov: 34)
  • Exomes 𝑓: 0.00012 (0 hom.)
• Consequence: TXNL4A NM_001305563.2 intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2 O:1
• Conservation: PhyloP100: 0.289

Genes affected

TXNL4A (HGNC:30551): (thioredoxin like 4A) The protein encoded by this gene is a member of the U5 small ribonucleoprotein particle (snRNP), and is involved in pre-mRNA splicing. This protein contains a thioredoxin-like fold and it is expected to interact with multiple proteins. Protein-protein interactions have been observed with the polyglutamine tract-binding protein 1 (PQBP1). Mutations in both the coding region and promoter region of this gene have been associated with Burn-McKeown syndrome, which is a rare disorder characterized by craniofacial dysmorphisms, cardiac defects, hearing loss, and bilateral choanal atresia. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 18-79988603-CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGT-C is Pathogenic according to our data. Variant chr18-79988603-CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGT-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 190413.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr18-79988603-CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGT-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TXNL4A	NM_006701.5	c.-245_-212delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		upstream_gene_variant		ENST00000269601.10	NP_006692.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TXNL4A	ENST00000585474.5	c.-60-10936_-60-10903delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		intron_variant		1		ENSP00000465572.1
TXNL4A	ENST00000592957.1	c.-60-10936_-60-10903delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		intron_variant		3		ENSP00000465493.1
TXNL4A	ENST00000269601.10	c.-245_-212delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		upstream_gene_variant		1	NM_006701.5	ENSP00000269601.4
TXNL4A	ENST00000585769.5	n.-245_-212delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		upstream_gene_variant		2		ENSP00000466266.1

Frequencies

GnomAD3 genomes AF: 0.000133 AC: 20 AN: 150720 Hom.: 0 Cov.: 34

Gnomad AFR AF: 0.0000972

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000664

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000193

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000208

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000125 AC: 33 AN: 264034 Hom.: 0 AF XY: 0.000128 AC XY: 17 AN XY: 133246

Gnomad4 AFR exome AF: 0.000301

Gnomad4 AMR exome AF: 0.000334

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000209

Gnomad4 SAS exome AF: 0.000193

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000131

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.000133 AC: 20 AN: 150720 Hom.: 0 Cov.: 34 AF XY: 0.0000815 AC XY: 6 AN XY: 73616

Gnomad4 AFR AF: 0.0000972

Gnomad4 AMR AF: 0.0000664

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000193

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000208

Gnomad4 OTH AF: 0.00

Alfa AF: 0.0000843 Hom.: 0

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Choanal atresia-hearing loss-cardiac defects-craniofacial dysmorphism syndrome Pathogenic:1 Other:1

Pathogenic, criteria provided, single submitter	research	Institute of Human Genetics Munich, Klinikum Rechts Der Isar, TU München	Dec 02, 2014	- -
not provided, no classification provided	literature only	GeneReviews	-	- -

TXNL4A-related disorder Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

PreventionGenetics, part of Exact Sciences

Dec 22, 2022

The TXNL4A c.-245_-212del34 variant is located in the 5' untranslated region. This deletion, referred to as the type 2 promoter deletion, has been reported in the homozygous state in multiple unrelated individuals with Burn-McKeown syndrome (Wieczorek et al. 2014. PubMed ID: 25434003; Goos et al. 2017. PubMed ID: 28905882; Narayanan et al. 2020. PubMed ID: 32187816). Functional studies found this variants reduces the activity of the putative TXNL4A promoter (Wieczorek et al. 2014. PubMed ID: 25434003). This variant is reported in 0.064% of alleles in individuals of East Asian descent in gnomAD (http://gnomad.broadinstitute.org/variant/18-77748603-CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGT-C). This variant is interpreted as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs786205699; hg19: chr18-77748603;