rs786205699

Variant names:

• chr18-79988603-CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGT-C
• rs786205699
• ENST00000585474.5:c.-60-10936_-60-10903delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PS3 PP5_Very_Strong

The NM_001305563.2(TXNL4A):​c.-60-10936_-60-10903delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000128 in 414,754 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV004113645: Functional studies found this variants reduces the activity of the putative TXNL4A promoter (Wieczorek et al. 2014. PubMed ID: 25434003).".

• Frequency:
  • Genomes: 𝑓 0.00013 (0 hom., cov: 34)
  • Exomes 𝑓: 0.00012 (0 hom.)
• Consequence: TXNL4A NM_001305563.2 intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3 O:1
• Conservation: PhyloP100: 0.289
• Publications: 1 publications found

Genes affected

TXNL4A (HGNC:30551): (thioredoxin like 4A) The protein encoded by this gene is a member of the U5 small ribonucleoprotein particle (snRNP), and is involved in pre-mRNA splicing. This protein contains a thioredoxin-like fold and it is expected to interact with multiple proteins. Protein-protein interactions have been observed with the polyglutamine tract-binding protein 1 (PQBP1). Mutations in both the coding region and promoter region of this gene have been associated with Burn-McKeown syndrome, which is a rare disorder characterized by craniofacial dysmorphisms, cardiac defects, hearing loss, and bilateral choanal atresia. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]

TXNL4A Gene-Disease associations (from GenCC):

• choanal atresia-hearing loss-cardiac defects-craniofacial dysmorphism syndrome

  Inheritance: AR, Unknown Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Ambry Genetics, Orphanet, G2P, Labcorp Genetics (formerly Invitae), ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV004113645: Functional studies found this variants reduces the activity of the putative TXNL4A promoter (Wieczorek et al. 2014. PubMed ID: 25434003).
• PP5: Variant 18-79988603-CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGT-C is Pathogenic according to our data. Variant chr18-79988603-CGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGT-C is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 190413.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001305563.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TXNL4A	NM_001305563.2		c.-60-10936_-60-10903delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		intron	N/A	NP_001292492.1	K7ESL1
	TXNL4A	NM_001305564.2		c.-60-10936_-60-10903delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		intron	N/A	NP_001292493.1	K7ESL1
	TXNL4A	NM_006701.5	MANE Select	c.-245_-212delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		upstream_gene	N/A	NP_006692.1	P83876

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TXNL4A	ENST00000585474.5	TSL:1	c.-60-10936_-60-10903delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		intron	N/A	ENSP00000465572.1	K7ESL1
	TXNL4A	ENST00000592957.1	TSL:3	c.-60-10936_-60-10903delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		intron	N/A	ENSP00000465493.1	K7ESL1
	TXNL4A	ENST00000269601.10	TSL:1 MANE Select	c.-245_-212delACATGCCGTCAGCACGCACGGCGCTAGCGCGCGC		upstream_gene	N/A	ENSP00000269601.4	P83876

Frequencies

GnomAD3 genomes AF: 0.000133 AC: 20 AN: 150720 Hom.: 0 Cov.: 34

Gnomad AFR AF: 0.0000972

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000664

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000193

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000208

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000125 AC: 33 AN: 264034 Hom.: 0 AF XY: 0.000128 AC XY: 17 AN XY: 133246

African (AFR) AF: 0.000301 AC: 2 AN: 6644

American (AMR) AF: 0.000334 AC: 2 AN: 5994

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 7516

East Asian (EAS) AF: 0.000209 AC: 4 AN: 19104

South Asian (SAS) AF: 0.000193 AC: 1 AN: 5172

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 19282

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1162

European-Non Finnish (NFE) AF: 0.000131 AC: 24 AN: 183834

Other (OTH) AF: 0.00 AC: 0 AN: 15326

GnomAD4 genome AF: 0.000133 AC: 20 AN: 150720 Hom.: 0 Cov.: 34 AF XY: 0.0000815 AC XY: 6 AN XY: 73616

African (AFR) AF: 0.0000972 AC: 4 AN: 41152

American (AMR) AF: 0.0000664 AC: 1 AN: 15062

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3330

East Asian (EAS) AF: 0.000193 AC: 1 AN: 5168

South Asian (SAS) AF: 0.00 AC: 0 AN: 4820

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10582

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.000208 AC: 14 AN: 67332

Other (OTH) AF: 0.00 AC: 0 AN: 2070

Alfa AF: 0.0000843 Hom.: 0

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Choanal atresia-hearing loss-cardiac defects-craniofacial dysmorphism syndrome (3)
1	-	-	TXNL4A-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.29
Mutation Taster		=17/83	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs786205699;

hg19: chr18-77748603;